ID: 940881305

View in Genome Browser
Species Human (GRCh38)
Location 2:158949536-158949558
Sequence ACTTAAGTCACCCATAGAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940881302_940881305 24 Left 940881302 2:158949489-158949511 CCCTTTGATGTCTTTTTTGTTTC No data
Right 940881305 2:158949536-158949558 ACTTAAGTCACCCATAGAAAAGG No data
940881303_940881305 23 Left 940881303 2:158949490-158949512 CCTTTGATGTCTTTTTTGTTTCT No data
Right 940881305 2:158949536-158949558 ACTTAAGTCACCCATAGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940881305 Original CRISPR ACTTAAGTCACCCATAGAAA AGG Intergenic
No off target data available for this crispr