ID: 940881387

View in Genome Browser
Species Human (GRCh38)
Location 2:158950353-158950375
Sequence CTGCTAAAACAGACCTAATA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940881384_940881387 4 Left 940881384 2:158950326-158950348 CCATAATCTATAATGCACCAACA No data
Right 940881387 2:158950353-158950375 CTGCTAAAACAGACCTAATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940881387 Original CRISPR CTGCTAAAACAGACCTAATA GGG Intergenic
No off target data available for this crispr