ID: 940883188

View in Genome Browser
Species Human (GRCh38)
Location 2:158967980-158968002
Sequence CCCGGGCGTCCCTGGGGCCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940883188_940883200 14 Left 940883188 2:158967980-158968002 CCGCGGCCCCAGGGACGCCCGGG No data
Right 940883200 2:158968017-158968039 AGAACGTCCCCCATTCCTTTTGG No data
940883188_940883201 15 Left 940883188 2:158967980-158968002 CCGCGGCCCCAGGGACGCCCGGG No data
Right 940883201 2:158968018-158968040 GAACGTCCCCCATTCCTTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940883188 Original CRISPR CCCGGGCGTCCCTGGGGCCG CGG (reversed) Intergenic