ID: 940883996

View in Genome Browser
Species Human (GRCh38)
Location 2:158973052-158973074
Sequence CCTGCAGGTGGGTGTGATCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940883988_940883996 8 Left 940883988 2:158973021-158973043 CCTTCTAGGGTCGGTGTTGTCTT No data
Right 940883996 2:158973052-158973074 CCTGCAGGTGGGTGTGATCAAGG No data
940883987_940883996 9 Left 940883987 2:158973020-158973042 CCCTTCTAGGGTCGGTGTTGTCT No data
Right 940883996 2:158973052-158973074 CCTGCAGGTGGGTGTGATCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940883996 Original CRISPR CCTGCAGGTGGGTGTGATCA AGG Intronic