ID: 940885519

View in Genome Browser
Species Human (GRCh38)
Location 2:158986387-158986409
Sequence CAAATTTCCAACCACCGACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940885519_940885525 25 Left 940885519 2:158986387-158986409 CCCAGTCGGTGGTTGGAAATTTG No data
Right 940885525 2:158986435-158986457 CTAATGATATACCTCCAGGTAGG No data
940885519_940885526 30 Left 940885519 2:158986387-158986409 CCCAGTCGGTGGTTGGAAATTTG No data
Right 940885526 2:158986440-158986462 GATATACCTCCAGGTAGGCATGG No data
940885519_940885524 21 Left 940885519 2:158986387-158986409 CCCAGTCGGTGGTTGGAAATTTG No data
Right 940885524 2:158986431-158986453 TAAGCTAATGATATACCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940885519 Original CRISPR CAAATTTCCAACCACCGACT GGG (reversed) Intronic