ID: 940885520 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:158986388-158986410 |
| Sequence | CCAAATTTCCAACCACCGAC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 940885520_940885524 | 20 | Left | 940885520 | 2:158986388-158986410 | CCAGTCGGTGGTTGGAAATTTGG | No data | ||
| Right | 940885524 | 2:158986431-158986453 | TAAGCTAATGATATACCTCCAGG | No data | ||||
| 940885520_940885525 | 24 | Left | 940885520 | 2:158986388-158986410 | CCAGTCGGTGGTTGGAAATTTGG | No data | ||
| Right | 940885525 | 2:158986435-158986457 | CTAATGATATACCTCCAGGTAGG | No data | ||||
| 940885520_940885526 | 29 | Left | 940885520 | 2:158986388-158986410 | CCAGTCGGTGGTTGGAAATTTGG | No data | ||
| Right | 940885526 | 2:158986440-158986462 | GATATACCTCCAGGTAGGCATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 940885520 | Original CRISPR | CCAAATTTCCAACCACCGAC TGG (reversed) | Intronic | ||