ID: 940885523

View in Genome Browser
Species Human (GRCh38)
Location 2:158986415-158986437
Sequence TAGCTTAAAAGAGTTTCCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940885523_940885532 27 Left 940885523 2:158986415-158986437 CCTGTGGAAACTCTTTTAAGCTA No data
Right 940885532 2:158986465-158986487 TTAGAATTTGTAGGAGGGCATGG No data
940885523_940885531 22 Left 940885523 2:158986415-158986437 CCTGTGGAAACTCTTTTAAGCTA No data
Right 940885531 2:158986460-158986482 TGGACTTAGAATTTGTAGGAGGG No data
940885523_940885529 18 Left 940885523 2:158986415-158986437 CCTGTGGAAACTCTTTTAAGCTA No data
Right 940885529 2:158986456-158986478 GGCATGGACTTAGAATTTGTAGG No data
940885523_940885526 2 Left 940885523 2:158986415-158986437 CCTGTGGAAACTCTTTTAAGCTA No data
Right 940885526 2:158986440-158986462 GATATACCTCCAGGTAGGCATGG No data
940885523_940885524 -7 Left 940885523 2:158986415-158986437 CCTGTGGAAACTCTTTTAAGCTA No data
Right 940885524 2:158986431-158986453 TAAGCTAATGATATACCTCCAGG No data
940885523_940885525 -3 Left 940885523 2:158986415-158986437 CCTGTGGAAACTCTTTTAAGCTA No data
Right 940885525 2:158986435-158986457 CTAATGATATACCTCCAGGTAGG No data
940885523_940885530 21 Left 940885523 2:158986415-158986437 CCTGTGGAAACTCTTTTAAGCTA No data
Right 940885530 2:158986459-158986481 ATGGACTTAGAATTTGTAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940885523 Original CRISPR TAGCTTAAAAGAGTTTCCAC AGG (reversed) Intronic