ID: 940885524

View in Genome Browser
Species Human (GRCh38)
Location 2:158986431-158986453
Sequence TAAGCTAATGATATACCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940885519_940885524 21 Left 940885519 2:158986387-158986409 CCCAGTCGGTGGTTGGAAATTTG No data
Right 940885524 2:158986431-158986453 TAAGCTAATGATATACCTCCAGG No data
940885523_940885524 -7 Left 940885523 2:158986415-158986437 CCTGTGGAAACTCTTTTAAGCTA No data
Right 940885524 2:158986431-158986453 TAAGCTAATGATATACCTCCAGG No data
940885520_940885524 20 Left 940885520 2:158986388-158986410 CCAGTCGGTGGTTGGAAATTTGG No data
Right 940885524 2:158986431-158986453 TAAGCTAATGATATACCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940885524 Original CRISPR TAAGCTAATGATATACCTCC AGG Intronic