ID: 940885525 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:158986435-158986457 |
Sequence | CTAATGATATACCTCCAGGT AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
940885523_940885525 | -3 | Left | 940885523 | 2:158986415-158986437 | CCTGTGGAAACTCTTTTAAGCTA | No data | ||
Right | 940885525 | 2:158986435-158986457 | CTAATGATATACCTCCAGGTAGG | No data | ||||
940885520_940885525 | 24 | Left | 940885520 | 2:158986388-158986410 | CCAGTCGGTGGTTGGAAATTTGG | No data | ||
Right | 940885525 | 2:158986435-158986457 | CTAATGATATACCTCCAGGTAGG | No data | ||||
940885519_940885525 | 25 | Left | 940885519 | 2:158986387-158986409 | CCCAGTCGGTGGTTGGAAATTTG | No data | ||
Right | 940885525 | 2:158986435-158986457 | CTAATGATATACCTCCAGGTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
940885525 | Original CRISPR | CTAATGATATACCTCCAGGT AGG | Intronic | ||