ID: 940885526

View in Genome Browser
Species Human (GRCh38)
Location 2:158986440-158986462
Sequence GATATACCTCCAGGTAGGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940885519_940885526 30 Left 940885519 2:158986387-158986409 CCCAGTCGGTGGTTGGAAATTTG No data
Right 940885526 2:158986440-158986462 GATATACCTCCAGGTAGGCATGG No data
940885520_940885526 29 Left 940885520 2:158986388-158986410 CCAGTCGGTGGTTGGAAATTTGG No data
Right 940885526 2:158986440-158986462 GATATACCTCCAGGTAGGCATGG No data
940885523_940885526 2 Left 940885523 2:158986415-158986437 CCTGTGGAAACTCTTTTAAGCTA No data
Right 940885526 2:158986440-158986462 GATATACCTCCAGGTAGGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940885526 Original CRISPR GATATACCTCCAGGTAGGCA TGG Intronic