ID: 940889264

View in Genome Browser
Species Human (GRCh38)
Location 2:159019152-159019174
Sequence AGACTGCTGACCTGCAATCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940889264_940889273 27 Left 940889264 2:159019152-159019174 CCGGGATTGCAGGTCAGCAGTCT No data
Right 940889273 2:159019202-159019224 CCTTAGGTGCAAGGTGCACTGGG No data
940889264_940889270 18 Left 940889264 2:159019152-159019174 CCGGGATTGCAGGTCAGCAGTCT No data
Right 940889270 2:159019193-159019215 CTTCGAGCACCTTAGGTGCAAGG No data
940889264_940889271 26 Left 940889264 2:159019152-159019174 CCGGGATTGCAGGTCAGCAGTCT No data
Right 940889271 2:159019201-159019223 ACCTTAGGTGCAAGGTGCACTGG No data
940889264_940889268 11 Left 940889264 2:159019152-159019174 CCGGGATTGCAGGTCAGCAGTCT No data
Right 940889268 2:159019186-159019208 CAAGCTCCTTCGAGCACCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940889264 Original CRISPR AGACTGCTGACCTGCAATCC CGG (reversed) Intronic
No off target data available for this crispr