ID: 940891068

View in Genome Browser
Species Human (GRCh38)
Location 2:159035947-159035969
Sequence CTGTGGGTCCTCCGGACAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940891062_940891068 11 Left 940891062 2:159035913-159035935 CCTGTTAGATTTAATTTTAAGGG No data
Right 940891068 2:159035947-159035969 CTGTGGGTCCTCCGGACAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940891068 Original CRISPR CTGTGGGTCCTCCGGACAGA GGG Intronic
No off target data available for this crispr