ID: 940892864 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:159051997-159052019 |
| Sequence | TAGGGCATACAGCTGGGGAA TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 940892855_940892864 | -3 | Left | 940892855 | 2:159051977-159051999 | CCTATGGGCATCCCCTGATTTAG | No data | ||
| Right | 940892864 | 2:159051997-159052019 | TAGGGCATACAGCTGGGGAATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 940892864 | Original CRISPR | TAGGGCATACAGCTGGGGAA TGG | Intronic | ||
| No off target data available for this crispr | |||||