ID: 940892864

View in Genome Browser
Species Human (GRCh38)
Location 2:159051997-159052019
Sequence TAGGGCATACAGCTGGGGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940892855_940892864 -3 Left 940892855 2:159051977-159051999 CCTATGGGCATCCCCTGATTTAG No data
Right 940892864 2:159051997-159052019 TAGGGCATACAGCTGGGGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940892864 Original CRISPR TAGGGCATACAGCTGGGGAA TGG Intronic
No off target data available for this crispr