ID: 940894211

View in Genome Browser
Species Human (GRCh38)
Location 2:159064759-159064781
Sequence CAGAGTAAGCAGAAGTTTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940894211_940894219 14 Left 940894211 2:159064759-159064781 CCACAAAACTTCTGCTTACTCTG No data
Right 940894219 2:159064796-159064818 GTGTGTGGTGTGTTACACTGAGG No data
940894211_940894217 -8 Left 940894211 2:159064759-159064781 CCACAAAACTTCTGCTTACTCTG No data
Right 940894217 2:159064774-159064796 TTACTCTGGGGGCTGAGAGGTGG No data
940894211_940894220 24 Left 940894211 2:159064759-159064781 CCACAAAACTTCTGCTTACTCTG No data
Right 940894220 2:159064806-159064828 TGTTACACTGAGGCCATTTGAGG No data
940894211_940894218 -1 Left 940894211 2:159064759-159064781 CCACAAAACTTCTGCTTACTCTG No data
Right 940894218 2:159064781-159064803 GGGGGCTGAGAGGTGGTGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940894211 Original CRISPR CAGAGTAAGCAGAAGTTTTG TGG (reversed) Intronic
No off target data available for this crispr