ID: 940898915

View in Genome Browser
Species Human (GRCh38)
Location 2:159108482-159108504
Sequence ACCTCAGAGAAAATAGATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940898912_940898915 7 Left 940898912 2:159108452-159108474 CCAGTACCATGCTCAGAAATGAA No data
Right 940898915 2:159108482-159108504 ACCTCAGAGAAAATAGATGAGGG No data
940898911_940898915 8 Left 940898911 2:159108451-159108473 CCCAGTACCATGCTCAGAAATGA No data
Right 940898915 2:159108482-159108504 ACCTCAGAGAAAATAGATGAGGG No data
940898913_940898915 1 Left 940898913 2:159108458-159108480 CCATGCTCAGAAATGAATGTTTT No data
Right 940898915 2:159108482-159108504 ACCTCAGAGAAAATAGATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940898915 Original CRISPR ACCTCAGAGAAAATAGATGA GGG Intronic
No off target data available for this crispr