ID: 940900821

View in Genome Browser
Species Human (GRCh38)
Location 2:159124859-159124881
Sequence TACTTGGTGAGGAGGGCGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940900821_940900835 29 Left 940900821 2:159124859-159124881 CCCCCCGCCCTCCTCACCAAGTA No data
Right 940900835 2:159124911-159124933 TTTGTATTTTTTTGTAGAGATGG 0: 1294
1: 10040
2: 11873
3: 22760
4: 154578

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940900821 Original CRISPR TACTTGGTGAGGAGGGCGGG GGG (reversed) Intronic
No off target data available for this crispr