ID: 940900821 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:159124859-159124881 |
| Sequence | TACTTGGTGAGGAGGGCGGG GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 940900821_940900835 | 29 | Left | 940900821 | 2:159124859-159124881 | CCCCCCGCCCTCCTCACCAAGTA | No data | ||
| Right | 940900835 | 2:159124911-159124933 | TTTGTATTTTTTTGTAGAGATGG | 0: 1294 1: 10040 2: 11873 3: 22760 4: 154578 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 940900821 | Original CRISPR | TACTTGGTGAGGAGGGCGGG GGG (reversed) | Intronic | ||
| No off target data available for this crispr | |||||