ID: 940901454

View in Genome Browser
Species Human (GRCh38)
Location 2:159130036-159130058
Sequence TACCGGGGGCGGCGGGGGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940901440_940901454 22 Left 940901440 2:159129991-159130013 CCTGTGCACGTTACAGCTGGAAA No data
Right 940901454 2:159130036-159130058 TACCGGGGGCGGCGGGGGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940901454 Original CRISPR TACCGGGGGCGGCGGGGGAC TGG Intronic
No off target data available for this crispr