ID: 940905165

View in Genome Browser
Species Human (GRCh38)
Location 2:159162442-159162464
Sequence TGGGATCCCCTTGCAACCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940905165_940905170 30 Left 940905165 2:159162442-159162464 CCTGTGGTTGCAAGGGGATCCCA No data
Right 940905170 2:159162495-159162517 CTCTTTGTAGAAGCTATGTAGGG No data
940905165_940905169 29 Left 940905165 2:159162442-159162464 CCTGTGGTTGCAAGGGGATCCCA No data
Right 940905169 2:159162494-159162516 ACTCTTTGTAGAAGCTATGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940905165 Original CRISPR TGGGATCCCCTTGCAACCAC AGG (reversed) Intronic
No off target data available for this crispr