ID: 940907147

View in Genome Browser
Species Human (GRCh38)
Location 2:159179655-159179677
Sequence TGGATCATGGTGCTCCCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940907147_940907155 15 Left 940907147 2:159179655-159179677 CCCAGAGGGAGCACCATGATCCA No data
Right 940907155 2:159179693-159179715 TCCACACCCTTCACCCTTTGTGG No data
940907147_940907161 30 Left 940907147 2:159179655-159179677 CCCAGAGGGAGCACCATGATCCA No data
Right 940907161 2:159179708-159179730 CTTTGTGGATGAGCTCTGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940907147 Original CRISPR TGGATCATGGTGCTCCCTCT GGG (reversed) Intronic
No off target data available for this crispr