ID: 940907148

View in Genome Browser
Species Human (GRCh38)
Location 2:159179656-159179678
Sequence TTGGATCATGGTGCTCCCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940907148_940907155 14 Left 940907148 2:159179656-159179678 CCAGAGGGAGCACCATGATCCAA No data
Right 940907155 2:159179693-159179715 TCCACACCCTTCACCCTTTGTGG No data
940907148_940907161 29 Left 940907148 2:159179656-159179678 CCAGAGGGAGCACCATGATCCAA No data
Right 940907161 2:159179708-159179730 CTTTGTGGATGAGCTCTGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940907148 Original CRISPR TTGGATCATGGTGCTCCCTC TGG (reversed) Intronic
No off target data available for this crispr