ID: 940907149

View in Genome Browser
Species Human (GRCh38)
Location 2:159179668-159179690
Sequence GGGGAGGCTAGATTGGATCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940907149_940907161 17 Left 940907149 2:159179668-159179690 CCATGATCCAATCTAGCCTCCCC No data
Right 940907161 2:159179708-159179730 CTTTGTGGATGAGCTCTGTGTGG No data
940907149_940907163 25 Left 940907149 2:159179668-159179690 CCATGATCCAATCTAGCCTCCCC No data
Right 940907163 2:159179716-159179738 ATGAGCTCTGTGTGGTGGACTGG No data
940907149_940907155 2 Left 940907149 2:159179668-159179690 CCATGATCCAATCTAGCCTCCCC No data
Right 940907155 2:159179693-159179715 TCCACACCCTTCACCCTTTGTGG No data
940907149_940907162 20 Left 940907149 2:159179668-159179690 CCATGATCCAATCTAGCCTCCCC No data
Right 940907162 2:159179711-159179733 TGTGGATGAGCTCTGTGTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940907149 Original CRISPR GGGGAGGCTAGATTGGATCA TGG (reversed) Intronic
No off target data available for this crispr