ID: 940907150

View in Genome Browser
Species Human (GRCh38)
Location 2:159179675-159179697
Sequence GTGGAGCGGGGAGGCTAGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940907150_940907164 24 Left 940907150 2:159179675-159179697 CCAATCTAGCCTCCCCGCTCCAC No data
Right 940907164 2:159179722-159179744 TCTGTGTGGTGGACTGGACCAGG No data
940907150_940907161 10 Left 940907150 2:159179675-159179697 CCAATCTAGCCTCCCCGCTCCAC No data
Right 940907161 2:159179708-159179730 CTTTGTGGATGAGCTCTGTGTGG No data
940907150_940907163 18 Left 940907150 2:159179675-159179697 CCAATCTAGCCTCCCCGCTCCAC No data
Right 940907163 2:159179716-159179738 ATGAGCTCTGTGTGGTGGACTGG No data
940907150_940907162 13 Left 940907150 2:159179675-159179697 CCAATCTAGCCTCCCCGCTCCAC No data
Right 940907162 2:159179711-159179733 TGTGGATGAGCTCTGTGTGGTGG No data
940907150_940907166 29 Left 940907150 2:159179675-159179697 CCAATCTAGCCTCCCCGCTCCAC No data
Right 940907166 2:159179727-159179749 GTGGTGGACTGGACCAGGCTGGG No data
940907150_940907155 -5 Left 940907150 2:159179675-159179697 CCAATCTAGCCTCCCCGCTCCAC No data
Right 940907155 2:159179693-159179715 TCCACACCCTTCACCCTTTGTGG No data
940907150_940907165 28 Left 940907150 2:159179675-159179697 CCAATCTAGCCTCCCCGCTCCAC No data
Right 940907165 2:159179726-159179748 TGTGGTGGACTGGACCAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940907150 Original CRISPR GTGGAGCGGGGAGGCTAGAT TGG (reversed) Intronic
No off target data available for this crispr