ID: 940907153

View in Genome Browser
Species Human (GRCh38)
Location 2:159179688-159179710
Sequence AAGGGTGAAGGGTGTGGAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940907153_940907166 16 Left 940907153 2:159179688-159179710 CCCGCTCCACACCCTTCACCCTT No data
Right 940907166 2:159179727-159179749 GTGGTGGACTGGACCAGGCTGGG No data
940907153_940907163 5 Left 940907153 2:159179688-159179710 CCCGCTCCACACCCTTCACCCTT No data
Right 940907163 2:159179716-159179738 ATGAGCTCTGTGTGGTGGACTGG No data
940907153_940907165 15 Left 940907153 2:159179688-159179710 CCCGCTCCACACCCTTCACCCTT No data
Right 940907165 2:159179726-159179748 TGTGGTGGACTGGACCAGGCTGG No data
940907153_940907162 0 Left 940907153 2:159179688-159179710 CCCGCTCCACACCCTTCACCCTT No data
Right 940907162 2:159179711-159179733 TGTGGATGAGCTCTGTGTGGTGG No data
940907153_940907161 -3 Left 940907153 2:159179688-159179710 CCCGCTCCACACCCTTCACCCTT No data
Right 940907161 2:159179708-159179730 CTTTGTGGATGAGCTCTGTGTGG No data
940907153_940907164 11 Left 940907153 2:159179688-159179710 CCCGCTCCACACCCTTCACCCTT No data
Right 940907164 2:159179722-159179744 TCTGTGTGGTGGACTGGACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940907153 Original CRISPR AAGGGTGAAGGGTGTGGAGC GGG (reversed) Intronic
No off target data available for this crispr