ID: 940907155

View in Genome Browser
Species Human (GRCh38)
Location 2:159179693-159179715
Sequence TCCACACCCTTCACCCTTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940907148_940907155 14 Left 940907148 2:159179656-159179678 CCAGAGGGAGCACCATGATCCAA No data
Right 940907155 2:159179693-159179715 TCCACACCCTTCACCCTTTGTGG No data
940907149_940907155 2 Left 940907149 2:159179668-159179690 CCATGATCCAATCTAGCCTCCCC No data
Right 940907155 2:159179693-159179715 TCCACACCCTTCACCCTTTGTGG No data
940907147_940907155 15 Left 940907147 2:159179655-159179677 CCCAGAGGGAGCACCATGATCCA No data
Right 940907155 2:159179693-159179715 TCCACACCCTTCACCCTTTGTGG No data
940907150_940907155 -5 Left 940907150 2:159179675-159179697 CCAATCTAGCCTCCCCGCTCCAC No data
Right 940907155 2:159179693-159179715 TCCACACCCTTCACCCTTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940907155 Original CRISPR TCCACACCCTTCACCCTTTG TGG Intronic
No off target data available for this crispr