ID: 940907156

View in Genome Browser
Species Human (GRCh38)
Location 2:159179694-159179716
Sequence TCCACAAAGGGTGAAGGGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940907156_940907165 9 Left 940907156 2:159179694-159179716 CCACACCCTTCACCCTTTGTGGA No data
Right 940907165 2:159179726-159179748 TGTGGTGGACTGGACCAGGCTGG No data
940907156_940907161 -9 Left 940907156 2:159179694-159179716 CCACACCCTTCACCCTTTGTGGA No data
Right 940907161 2:159179708-159179730 CTTTGTGGATGAGCTCTGTGTGG No data
940907156_940907162 -6 Left 940907156 2:159179694-159179716 CCACACCCTTCACCCTTTGTGGA No data
Right 940907162 2:159179711-159179733 TGTGGATGAGCTCTGTGTGGTGG No data
940907156_940907164 5 Left 940907156 2:159179694-159179716 CCACACCCTTCACCCTTTGTGGA No data
Right 940907164 2:159179722-159179744 TCTGTGTGGTGGACTGGACCAGG No data
940907156_940907166 10 Left 940907156 2:159179694-159179716 CCACACCCTTCACCCTTTGTGGA No data
Right 940907166 2:159179727-159179749 GTGGTGGACTGGACCAGGCTGGG No data
940907156_940907163 -1 Left 940907156 2:159179694-159179716 CCACACCCTTCACCCTTTGTGGA No data
Right 940907163 2:159179716-159179738 ATGAGCTCTGTGTGGTGGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940907156 Original CRISPR TCCACAAAGGGTGAAGGGTG TGG (reversed) Intronic