ID: 940907157

View in Genome Browser
Species Human (GRCh38)
Location 2:159179699-159179721
Sequence GCTCATCCACAAAGGGTGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940907157_940907164 0 Left 940907157 2:159179699-159179721 CCCTTCACCCTTTGTGGATGAGC No data
Right 940907164 2:159179722-159179744 TCTGTGTGGTGGACTGGACCAGG No data
940907157_940907163 -6 Left 940907157 2:159179699-159179721 CCCTTCACCCTTTGTGGATGAGC No data
Right 940907163 2:159179716-159179738 ATGAGCTCTGTGTGGTGGACTGG No data
940907157_940907169 29 Left 940907157 2:159179699-159179721 CCCTTCACCCTTTGTGGATGAGC No data
Right 940907169 2:159179751-159179773 TGCAGTTCTCCTTGCTGCCTGGG No data
940907157_940907166 5 Left 940907157 2:159179699-159179721 CCCTTCACCCTTTGTGGATGAGC No data
Right 940907166 2:159179727-159179749 GTGGTGGACTGGACCAGGCTGGG No data
940907157_940907168 28 Left 940907157 2:159179699-159179721 CCCTTCACCCTTTGTGGATGAGC No data
Right 940907168 2:159179750-159179772 ATGCAGTTCTCCTTGCTGCCTGG No data
940907157_940907165 4 Left 940907157 2:159179699-159179721 CCCTTCACCCTTTGTGGATGAGC No data
Right 940907165 2:159179726-159179748 TGTGGTGGACTGGACCAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940907157 Original CRISPR GCTCATCCACAAAGGGTGAA GGG (reversed) Intronic
No off target data available for this crispr