ID: 940907162

View in Genome Browser
Species Human (GRCh38)
Location 2:159179711-159179733
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940907153_940907162 0 Left 940907153 2:159179688-159179710 CCCGCTCCACACCCTTCACCCTT No data
Right 940907162 2:159179711-159179733 TGTGGATGAGCTCTGTGTGGTGG No data
940907150_940907162 13 Left 940907150 2:159179675-159179697 CCAATCTAGCCTCCCCGCTCCAC No data
Right 940907162 2:159179711-159179733 TGTGGATGAGCTCTGTGTGGTGG No data
940907156_940907162 -6 Left 940907156 2:159179694-159179716 CCACACCCTTCACCCTTTGTGGA No data
Right 940907162 2:159179711-159179733 TGTGGATGAGCTCTGTGTGGTGG No data
940907149_940907162 20 Left 940907149 2:159179668-159179690 CCATGATCCAATCTAGCCTCCCC No data
Right 940907162 2:159179711-159179733 TGTGGATGAGCTCTGTGTGGTGG No data
940907152_940907162 1 Left 940907152 2:159179687-159179709 CCCCGCTCCACACCCTTCACCCT No data
Right 940907162 2:159179711-159179733 TGTGGATGAGCTCTGTGTGGTGG No data
940907151_940907162 4 Left 940907151 2:159179684-159179706 CCTCCCCGCTCCACACCCTTCAC No data
Right 940907162 2:159179711-159179733 TGTGGATGAGCTCTGTGTGGTGG No data
940907154_940907162 -1 Left 940907154 2:159179689-159179711 CCGCTCCACACCCTTCACCCTTT No data
Right 940907162 2:159179711-159179733 TGTGGATGAGCTCTGTGTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr