ID: 940907166

View in Genome Browser
Species Human (GRCh38)
Location 2:159179727-159179749
Sequence GTGGTGGACTGGACCAGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940907160_940907166 -3 Left 940907160 2:159179707-159179729 CCTTTGTGGATGAGCTCTGTGTG No data
Right 940907166 2:159179727-159179749 GTGGTGGACTGGACCAGGCTGGG No data
940907157_940907166 5 Left 940907157 2:159179699-159179721 CCCTTCACCCTTTGTGGATGAGC No data
Right 940907166 2:159179727-159179749 GTGGTGGACTGGACCAGGCTGGG No data
940907154_940907166 15 Left 940907154 2:159179689-159179711 CCGCTCCACACCCTTCACCCTTT No data
Right 940907166 2:159179727-159179749 GTGGTGGACTGGACCAGGCTGGG No data
940907158_940907166 4 Left 940907158 2:159179700-159179722 CCTTCACCCTTTGTGGATGAGCT No data
Right 940907166 2:159179727-159179749 GTGGTGGACTGGACCAGGCTGGG No data
940907150_940907166 29 Left 940907150 2:159179675-159179697 CCAATCTAGCCTCCCCGCTCCAC No data
Right 940907166 2:159179727-159179749 GTGGTGGACTGGACCAGGCTGGG No data
940907156_940907166 10 Left 940907156 2:159179694-159179716 CCACACCCTTCACCCTTTGTGGA No data
Right 940907166 2:159179727-159179749 GTGGTGGACTGGACCAGGCTGGG No data
940907152_940907166 17 Left 940907152 2:159179687-159179709 CCCCGCTCCACACCCTTCACCCT No data
Right 940907166 2:159179727-159179749 GTGGTGGACTGGACCAGGCTGGG No data
940907151_940907166 20 Left 940907151 2:159179684-159179706 CCTCCCCGCTCCACACCCTTCAC No data
Right 940907166 2:159179727-159179749 GTGGTGGACTGGACCAGGCTGGG No data
940907159_940907166 -2 Left 940907159 2:159179706-159179728 CCCTTTGTGGATGAGCTCTGTGT No data
Right 940907166 2:159179727-159179749 GTGGTGGACTGGACCAGGCTGGG No data
940907153_940907166 16 Left 940907153 2:159179688-159179710 CCCGCTCCACACCCTTCACCCTT No data
Right 940907166 2:159179727-159179749 GTGGTGGACTGGACCAGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940907166 Original CRISPR GTGGTGGACTGGACCAGGCT GGG Intronic
No off target data available for this crispr