ID: 940907389

View in Genome Browser
Species Human (GRCh38)
Location 2:159181383-159181405
Sequence AGAATGGTGTGAACCCCAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2703
Summary {0: 18, 1: 377, 2: 450, 3: 646, 4: 1212}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940907389_940907399 13 Left 940907389 2:159181383-159181405 CCCCCTGGGGTTCACACCATTCT 0: 18
1: 377
2: 450
3: 646
4: 1212
Right 940907399 2:159181419-159181441 TCCCACGTAGCTGGGACTACAGG 0: 340
1: 44823
2: 159981
3: 222097
4: 228517
940907389_940907397 5 Left 940907389 2:159181383-159181405 CCCCCTGGGGTTCACACCATTCT 0: 18
1: 377
2: 450
3: 646
4: 1212
Right 940907397 2:159181411-159181433 CTCAGCCTTCCCACGTAGCTGGG No data
940907389_940907396 4 Left 940907389 2:159181383-159181405 CCCCCTGGGGTTCACACCATTCT 0: 18
1: 377
2: 450
3: 646
4: 1212
Right 940907396 2:159181410-159181432 CCTCAGCCTTCCCACGTAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940907389 Original CRISPR AGAATGGTGTGAACCCCAGG GGG (reversed) Intronic
Too many off-targets to display for this crispr