ID: 940916817

View in Genome Browser
Species Human (GRCh38)
Location 2:159265434-159265456
Sequence TTACAAAGACTGACCCGGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940916813_940916817 21 Left 940916813 2:159265390-159265412 CCTAAACTCTGAGACCTTCTGGA No data
Right 940916817 2:159265434-159265456 TTACAAAGACTGACCCGGCTAGG No data
940916815_940916817 7 Left 940916815 2:159265404-159265426 CCTTCTGGAAACAGGCAGACTTT No data
Right 940916817 2:159265434-159265456 TTACAAAGACTGACCCGGCTAGG No data
940916811_940916817 30 Left 940916811 2:159265381-159265403 CCAAGGAATCCTAAACTCTGAGA No data
Right 940916817 2:159265434-159265456 TTACAAAGACTGACCCGGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940916817 Original CRISPR TTACAAAGACTGACCCGGCT AGG Intronic
No off target data available for this crispr