ID: 940917403

View in Genome Browser
Species Human (GRCh38)
Location 2:159271959-159271981
Sequence TGGGATGCAGTGTGATTAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 125}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940917399_940917403 11 Left 940917399 2:159271925-159271947 CCTCATGCAGCTCAGATATCTAT 0: 1
1: 0
2: 1
3: 14
4: 184
Right 940917403 2:159271959-159271981 TGGGATGCAGTGTGATTAACTGG 0: 1
1: 0
2: 0
3: 5
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940917403 Original CRISPR TGGGATGCAGTGTGATTAAC TGG Intronic
901549754 1:9987146-9987168 TGGAATGCAGTGTCATGATCAGG - Intergenic
905683592 1:39892520-39892542 TGGGAAGCAGTATGGTTAAGTGG - Intergenic
906828296 1:49005397-49005419 TGGGATGAAGTGGGATGAAGAGG - Intronic
909151687 1:72013865-72013887 TTGCATGCAGTATGATTAATAGG + Intronic
910272645 1:85413240-85413262 TGGGATCCAGTGTCCTTAAATGG - Intronic
911980901 1:104564556-104564578 TGGGCTGCAGTATGGATAACAGG + Intergenic
916365522 1:164022908-164022930 TTGGATGCAGTATAGTTAACTGG + Intergenic
1064716213 10:18179389-18179411 TGGGATGCAGGGAGAAAAACAGG - Intronic
1072544057 10:96420759-96420781 TGGGATTCAATCTTATTAACGGG + Intronic
1073421122 10:103424571-103424593 TGGGTTGAAGAGTGATTAATTGG + Intronic
1073571051 10:104581483-104581505 TGGGATGCTCTGTGAGGAACAGG + Intergenic
1075412728 10:122240855-122240877 TGGGAGGCAGTATGACAAACAGG + Intronic
1075739107 10:124682646-124682668 TGGGAGGCAGTGTGGTACACTGG - Intronic
1076786707 10:132753290-132753312 TGCGGTGCTGTGTGTTTAACCGG - Intronic
1078540002 11:12205785-12205807 TGGGATGCAATGTGTTTTCCTGG - Intronic
1081689336 11:45066435-45066457 AGGGATGCAGTGAGGTGAACTGG - Intergenic
1089757202 11:120695726-120695748 TGAGATGCAGTGTCATTAGCAGG + Intronic
1092124546 12:6066074-6066096 TGGGTTGCAGGGTGATGAAGGGG - Intronic
1095717711 12:45365726-45365748 TGGGAATCAGTGAGGTTAACAGG + Intronic
1105763460 13:23534436-23534458 TGGGATGCAGTGTGCTTGCTGGG + Intergenic
1106168468 13:27269693-27269715 TGGGGGGCAGTGTGAGGAACAGG - Intergenic
1107736466 13:43404298-43404320 TGGGATGGAGTGGGATTGGCAGG - Intronic
1108864145 13:54902137-54902159 TTGGATGCATTGTGAGTAATTGG + Intergenic
1108979157 13:56488768-56488790 TGGGGTACAGTGTGATTTATTGG - Intergenic
1109326827 13:60878101-60878123 TGGGATGGAGTGAGAATGACAGG - Intergenic
1111980978 13:95014661-95014683 TGTGCTGCAGTTTGATTATCTGG - Intergenic
1113819407 13:113202225-113202247 TGGGCTCCAGTGTGTTGAACTGG - Intronic
1113998183 14:16105179-16105201 TGGGATGGAGTGGAATTAAATGG - Intergenic
1117056433 14:51916717-51916739 AGGGGTGCAGTGTGATGGACAGG + Intronic
1117995001 14:61470156-61470178 TAGGATGCAGTGAGATTACTGGG + Intronic
1118743564 14:68758390-68758412 TGGGAAGGAGTCTGATGAACGGG + Intergenic
1119997784 14:79272166-79272188 TGGGAAGCAGTGTATTTAAATGG + Intronic
1123584889 15:21750079-21750101 TGGGATTCAGTGTGATAGATAGG + Intergenic
1123621534 15:22192686-22192708 TGGGATTCAGTGTGATAGATAGG + Intergenic
1128882883 15:71259685-71259707 TGGGATGCAGTCTGAACATCAGG + Intronic
1132481513 16:168588-168610 TGGGATGCAGGGTCATTGGCTGG - Intergenic
1133427248 16:5703385-5703407 TGGGATGGAGTTTGGTTCACTGG + Intergenic
1137056737 16:35749691-35749713 TGGCATGCATTGTGATCAGCGGG - Intergenic
1137520304 16:49189484-49189506 TGAGATGCAGTCTGGCTAACAGG - Intergenic
1140782177 16:78306763-78306785 TGGGAAGGAGTGAGATTTACAGG - Intronic
1140782190 16:78306821-78306843 TGGGAAGGAGTGAGATTTACAGG - Intronic
1143114070 17:4571237-4571259 TGGGATGAGGTGTGATCAATGGG - Intergenic
1145698038 17:26805272-26805294 TGGAATGCAGTGTAATTGAGTGG + Intergenic
1146304644 17:31721710-31721732 TGGGGTGGAGTGTGAATAAGGGG + Intergenic
1147239770 17:39083152-39083174 AGGAATCCAGTGTGTTTAACTGG + Intronic
1147904320 17:43813083-43813105 AGGGATGCAGTGTGAATGCCTGG - Intronic
1149691603 17:58581793-58581815 TTGGATGCAGTGTTAACAACGGG + Intronic
1150946683 17:69754230-69754252 TGGTATGCTGTGTGTTTAGCAGG + Intergenic
1151621613 17:75248947-75248969 TGGGAAGCAGGGTGATACACTGG - Intronic
1155876807 18:31099916-31099938 TGGGATGCAGTGGCATGACCAGG + Intronic
1157090174 18:44627599-44627621 TGGGATGAAGTCTGAGTAGCAGG - Intergenic
1157593070 18:48847760-48847782 TGAGATGCAGAGTGATTAAGTGG + Intronic
1162552518 19:11365497-11365519 TGGGGGGCAGTGTGAAGAACAGG - Exonic
1164550481 19:29207154-29207176 TGGGATGAAGTAAAATTAACGGG - Exonic
1165276138 19:34753170-34753192 TGGGATGCCGTGTTACAAACTGG + Intergenic
1167856703 19:52247788-52247810 CAGGATGCAGTGTGTTTAAAGGG + Intergenic
931244740 2:60482652-60482674 TGGGATGCAGTGTGCTTTCAGGG - Intronic
935707165 2:105867000-105867022 TGGTATGTAGGATGATTAACAGG - Intronic
940917403 2:159271959-159271981 TGGGATGCAGTGTGATTAACTGG + Intronic
945289310 2:208112070-208112092 TGTGATGCAGTGCTTTTAACTGG - Intergenic
945381440 2:209145775-209145797 TGTGATGCAGTGCTTTTAACTGG + Intergenic
948391858 2:237617495-237617517 TGGGATTAACTGTGATTAACTGG + Intergenic
1170360552 20:15541447-15541469 TGTGATGAGTTGTGATTAACAGG + Intronic
1170778549 20:19402807-19402829 TGGGATGCATTGAGCTTAGCAGG + Intronic
1174336546 20:49865661-49865683 TGGGCTGCTGAGTGATTACCAGG - Intronic
1175613868 20:60375679-60375701 TGGGAGGCAGGGTGATTTTCTGG - Intergenic
1177421876 21:20870061-20870083 TGGGATGGAGTGAGAATAGCAGG - Intergenic
1180137141 21:45869186-45869208 TGGGAGGTTGTGGGATTAACAGG + Intronic
1180900196 22:19365992-19366014 TGGAGTGCAGTGTTATTCACAGG - Intronic
1180913151 22:19467470-19467492 TGGCATGCAGTGAGGTTGACGGG + Intronic
1181078704 22:20399968-20399990 TGGGATGCAGTGAAATTACTTGG + Intronic
1183766095 22:39876486-39876508 TGGGATGAAGTAAAATTAACGGG + Intronic
1183859386 22:40658488-40658510 TGGAGTGTAGTGTGATTCACAGG + Intergenic
949893018 3:8747168-8747190 TGGGAGGCAGTGTGGTGAAGTGG + Intronic
955808403 3:62760569-62760591 TGGCAGGCAGAGTGATTAAGAGG - Intronic
959096260 3:101959298-101959320 TGGTATGGAGTGTGTTTAAGTGG + Intergenic
960683122 3:120269829-120269851 TGGGATGCAGTCAAATTAACTGG + Intronic
960921785 3:122754483-122754505 GGGAATGCAGAGTGACTAACAGG + Intronic
961457332 3:127030704-127030726 TGGGCTGCAGCGTGAGAAACAGG + Intronic
964550237 3:157877434-157877456 GGGGCTGCAGTGTGATTTCCAGG + Intergenic
965868613 3:173238107-173238129 TGGGAAGCAATGTCATTAAATGG - Intergenic
970146574 4:13042364-13042386 TGGGATGAACTATGATCAACGGG + Intergenic
971985489 4:33817373-33817395 TGGAAAGAAGTGTGCTTAACAGG + Intergenic
974400578 4:61400517-61400539 TGGGATTCCCTGTGAATAACTGG + Intronic
975658847 4:76668252-76668274 TGTGGTGCAGTTTGATTAAAAGG + Intronic
976579628 4:86720826-86720848 TGGGATGGGGGGAGATTAACAGG + Intronic
977227838 4:94414530-94414552 TGAGATGTAGTGTGAAGAACAGG + Intergenic
977492291 4:97731034-97731056 TGGGAGCCAGTGTGATTATTTGG + Intronic
979632156 4:122915418-122915440 TGGAATGCAGTGTCATGATCTGG - Intronic
984397967 4:179225114-179225136 AGGAATGCAGTGTGGTCAACTGG - Intergenic
984623561 4:181979959-181979981 TGAGATCCAGTGTGACTCACAGG - Intergenic
984658223 4:182343202-182343224 TGGAATTCACTGTGATTAAAAGG - Intronic
985421670 4:189790821-189790843 TGTGATGCAGTGTGAGTTGCCGG - Intergenic
992096128 5:73364473-73364495 TGTGAGGCAGTGTTATTAAGAGG - Intergenic
996169893 5:120276626-120276648 TGGTAAGCAGTGTGAATAAAAGG + Intergenic
996478966 5:123951802-123951824 TGGAAGGCAGTGTGATTCATTGG - Intergenic
999974493 5:156897396-156897418 TGGTATGCAATATGTTTAACTGG - Intergenic
1000107904 5:158078197-158078219 TGGGATGCAATGTCATGAAGTGG + Intergenic
1000305938 5:159994760-159994782 TGGGAGGCAGTGAGAGTGACTGG - Intergenic
1000362315 5:160459240-160459262 TGGGAGGCAGTGTGATAGAGAGG - Intergenic
1001706965 5:173748532-173748554 TGGGATGGTGTGTGATGGACAGG + Intergenic
1003344114 6:5249847-5249869 TGGGATTCAGTGTGAAGAAAGGG + Intronic
1004979064 6:21002374-21002396 TGGGATGGAGTGTGATCTCCAGG - Intronic
1007325525 6:41056566-41056588 TTGGATGCAGTGTGATGATTTGG - Intronic
1009925253 6:70113026-70113048 TCAGAGGCAGTGCGATTAACAGG - Intronic
1010360028 6:74982397-74982419 TGGGAATCAGTGTGCTCAACAGG - Intergenic
1011650786 6:89504282-89504304 TGGGATGCTGTGAGGTTAAATGG + Intronic
1014760883 6:125355663-125355685 GGAGATGAAGTGGGATTAACAGG + Intergenic
1016944769 6:149519894-149519916 TTTGATGCAGTGTTTTTAACAGG - Intronic
1018278135 6:162154549-162154571 TGAGATGAAGTGTGTTTAAATGG + Intronic
1019096394 6:169584081-169584103 TGGAAGGAAGTGTGGTTAACAGG - Intronic
1021698030 7:23292608-23292630 TTTGAGGCATTGTGATTAACGGG - Intergenic
1029309862 7:99653060-99653082 TGGGAAGAAATGTGATTAATGGG + Intronic
1029869144 7:103670398-103670420 TGGGGTTCAGTTAGATTAACTGG + Intronic
1030574463 7:111268640-111268662 TGGAATGCAGTGGCATGAACGGG + Intronic
1030760147 7:113340500-113340522 TGGGATGCTCTTTGCTTAACTGG + Intergenic
1035421230 7:158730262-158730284 GGGGATGCAGTGGGATGAACTGG + Intergenic
1040447125 8:47506816-47506838 AGGGATTGAGTGTAATTAACCGG + Intronic
1045507184 8:102787177-102787199 TGGAATGCAGTGTCATGATCCGG + Intergenic
1046317792 8:112529722-112529744 CGGGATGCAGTGTGTATAATTGG + Intronic
1046617784 8:116496514-116496536 TGAGATGCAGTGACATTAAATGG - Intergenic
1047429413 8:124777964-124777986 TGGGATGCGCTGTGCTGAACTGG + Intergenic
1051355470 9:16236070-16236092 TGGGATGCAGAGTGGTGAGCAGG - Intronic
1056114318 9:83426971-83426993 TGGGAAGCAATGTCATTAAGGGG - Intronic
1058634301 9:107021482-107021504 TGGGATGCATGGTGACTGACTGG - Intergenic
1059913970 9:119077945-119077967 TGAGATGCAGGGTGGTTAAGTGG + Intergenic
1188598647 X:31932945-31932967 TGGTATCCAGTGTGTTCAACAGG - Intronic
1191030224 X:55961575-55961597 TGGTATGCACAGTGAATAACTGG - Intergenic
1196732793 X:118957983-118958005 TGGGATACTTTGTGATGAACTGG - Intergenic
1201106150 Y:10764886-10764908 TGGGATGGAGTGTAATGAAGTGG - Intergenic
1201132563 Y:10964271-10964293 TGGGTTGCAATGGAATTAACTGG - Intergenic