ID: 940927071

View in Genome Browser
Species Human (GRCh38)
Location 2:159376071-159376093
Sequence AAGCATGAACAGAAGGTACA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940927069_940927071 0 Left 940927069 2:159376048-159376070 CCAAATTGTAGGTTTTAGAGGGA No data
Right 940927071 2:159376071-159376093 AAGCATGAACAGAAGGTACACGG No data
940927065_940927071 28 Left 940927065 2:159376020-159376042 CCAGAAAATGACAACAGAAGAAC No data
Right 940927071 2:159376071-159376093 AAGCATGAACAGAAGGTACACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940927071 Original CRISPR AAGCATGAACAGAAGGTACA CGG Intronic
No off target data available for this crispr