ID: 940929705

View in Genome Browser
Species Human (GRCh38)
Location 2:159413404-159413426
Sequence CAAACTGGCTGGGCGCGGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940929699_940929705 16 Left 940929699 2:159413365-159413387 CCAATTTGTGGACCTTACTTGGA No data
Right 940929705 2:159413404-159413426 CAAACTGGCTGGGCGCGGACTGG No data
940929697_940929705 17 Left 940929697 2:159413364-159413386 CCCAATTTGTGGACCTTACTTGG No data
Right 940929705 2:159413404-159413426 CAAACTGGCTGGGCGCGGACTGG No data
940929700_940929705 4 Left 940929700 2:159413377-159413399 CCTTACTTGGATACTTATTTAAA No data
Right 940929705 2:159413404-159413426 CAAACTGGCTGGGCGCGGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940929705 Original CRISPR CAAACTGGCTGGGCGCGGAC TGG Intronic
No off target data available for this crispr