ID: 940930007

View in Genome Browser
Species Human (GRCh38)
Location 2:159416898-159416920
Sequence GTTCTCACCCACAATTATTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940930007_940930008 11 Left 940930007 2:159416898-159416920 CCAAAATAATTGTGGGTGAGAAC No data
Right 940930008 2:159416932-159416954 TTCTCAATAAATTTTTCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940930007 Original CRISPR GTTCTCACCCACAATTATTT TGG (reversed) Intronic
No off target data available for this crispr