ID: 940932439

View in Genome Browser
Species Human (GRCh38)
Location 2:159449573-159449595
Sequence ATGGTAGCTGCCAGTCTCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940932436_940932439 27 Left 940932436 2:159449523-159449545 CCTTCATTATCTAATGGCAAAAT No data
Right 940932439 2:159449573-159449595 ATGGTAGCTGCCAGTCTCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940932439 Original CRISPR ATGGTAGCTGCCAGTCTCAA AGG Intronic
No off target data available for this crispr