ID: 940938360

View in Genome Browser
Species Human (GRCh38)
Location 2:159526043-159526065
Sequence AAGAGTGACAAATGAGGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940938353_940938360 25 Left 940938353 2:159525995-159526017 CCTGAGATAATTTAGGCAAAAGT No data
Right 940938360 2:159526043-159526065 AAGAGTGACAAATGAGGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940938360 Original CRISPR AAGAGTGACAAATGAGGGGA TGG Intronic
No off target data available for this crispr