ID: 940948463

View in Genome Browser
Species Human (GRCh38)
Location 2:159645381-159645403
Sequence ATTTTCCCACAGATGGAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940948460_940948463 2 Left 940948460 2:159645356-159645378 CCAGGGACCAGTTTCGTGGAAGA 0: 95
1: 688
2: 1087
3: 1509
4: 1213
Right 940948463 2:159645381-159645403 ATTTTCCCACAGATGGAGCAAGG No data
940948458_940948463 13 Left 940948458 2:159645345-159645367 CCTTTTCGGCACCAGGGACCAGT No data
Right 940948463 2:159645381-159645403 ATTTTCCCACAGATGGAGCAAGG No data
940948455_940948463 19 Left 940948455 2:159645339-159645361 CCCTAACCTTTTCGGCACCAGGG No data
Right 940948463 2:159645381-159645403 ATTTTCCCACAGATGGAGCAAGG No data
940948457_940948463 18 Left 940948457 2:159645340-159645362 CCTAACCTTTTCGGCACCAGGGA 0: 17
1: 1035
2: 1639
3: 1382
4: 953
Right 940948463 2:159645381-159645403 ATTTTCCCACAGATGGAGCAAGG No data
940948461_940948463 -5 Left 940948461 2:159645363-159645385 CCAGTTTCGTGGAAGACAATTTT 0: 138
1: 868
2: 1088
3: 701
4: 440
Right 940948463 2:159645381-159645403 ATTTTCCCACAGATGGAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940948463 Original CRISPR ATTTTCCCACAGATGGAGCA AGG Intergenic
No off target data available for this crispr