ID: 940951948

View in Genome Browser
Species Human (GRCh38)
Location 2:159685618-159685640
Sequence GCTTTTGTGGCCCTTTAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940951948_940951951 0 Left 940951948 2:159685618-159685640 CCATGTTAAAGGGCCACAAAAGC No data
Right 940951951 2:159685641-159685663 CTACCACAGAGAACTCCCCATGG No data
940951948_940951953 10 Left 940951948 2:159685618-159685640 CCATGTTAAAGGGCCACAAAAGC No data
Right 940951953 2:159685651-159685673 GAACTCCCCATGGCCAATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940951948 Original CRISPR GCTTTTGTGGCCCTTTAACA TGG (reversed) Intergenic
No off target data available for this crispr