ID: 940951949

View in Genome Browser
Species Human (GRCh38)
Location 2:159685631-159685653
Sequence TTCTCTGTGGTAGGCTTTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940951949_940951958 26 Left 940951949 2:159685631-159685653 CCACAAAAGCCTACCACAGAGAA No data
Right 940951958 2:159685680-159685702 TTGAGTGACAAAACAAATAATGG No data
940951949_940951953 -3 Left 940951949 2:159685631-159685653 CCACAAAAGCCTACCACAGAGAA No data
Right 940951953 2:159685651-159685673 GAACTCCCCATGGCCAATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940951949 Original CRISPR TTCTCTGTGGTAGGCTTTTG TGG (reversed) Intergenic
No off target data available for this crispr