ID: 940951953

View in Genome Browser
Species Human (GRCh38)
Location 2:159685651-159685673
Sequence GAACTCCCCATGGCCAATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940951948_940951953 10 Left 940951948 2:159685618-159685640 CCATGTTAAAGGGCCACAAAAGC No data
Right 940951953 2:159685651-159685673 GAACTCCCCATGGCCAATGCTGG No data
940951949_940951953 -3 Left 940951949 2:159685631-159685653 CCACAAAAGCCTACCACAGAGAA No data
Right 940951953 2:159685651-159685673 GAACTCCCCATGGCCAATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940951953 Original CRISPR GAACTCCCCATGGCCAATGC TGG Intergenic
No off target data available for this crispr