ID: 940952622

View in Genome Browser
Species Human (GRCh38)
Location 2:159693310-159693332
Sequence ACTGGTGCTTTTTTATGAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 292
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 265}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940952622 Original CRISPR ACTGGTGCTTTTTTATGAGG TGG Intergenic
900742206 1:4337506-4337528 ACAAGTGCTTTTTTAGGATGTGG - Intergenic
901647821 1:10726219-10726241 TCTGTTGCTGTTTAATGAGGTGG - Intronic
903696623 1:25212157-25212179 ACTGGTGATTTTGAATGAGGGGG - Intergenic
908202647 1:61813479-61813501 ACTAGTGAGTTTTTATAAGGTGG - Intronic
909451530 1:75802947-75802969 ACTGGTGGTTTTATAAGAAGAGG - Intronic
909962778 1:81868015-81868037 AGTGGAGCTTTTTTATTAAGTGG - Intronic
910882518 1:91935109-91935131 ACTGGTGTTTTTATAAGAAGAGG - Intergenic
911739056 1:101367655-101367677 ATTGGTGCTTCTTGGTGAGGAGG - Intergenic
914435161 1:147653133-147653155 ACTGGTTTTTTTTTTTGAGATGG + Intronic
914770916 1:150684051-150684073 ACTGGTGTTCTTTTGAGAGGAGG + Intronic
915939195 1:160107920-160107942 ATTAGTGCTCTTTTAAGAGGAGG - Intergenic
918103121 1:181393765-181393787 ACTGGTGATCTTTTCTGATGGGG + Intergenic
920657784 1:207889175-207889197 ATTGGTGCTTTTTCATAAGTTGG + Exonic
921337316 1:214101206-214101228 ACTGGTGTCTTTATAAGAGGAGG - Intergenic
922082225 1:222308446-222308468 ATTGGTGCTTGTTTCAGAGGAGG - Intergenic
923258707 1:232245777-232245799 ACTGGTGCCTTTATAAGAAGAGG - Intergenic
923767012 1:236901738-236901760 ATTAGTGCCTTTTTAAGAGGAGG - Exonic
1065904642 10:30239323-30239345 TCTGGTGCTTTTTGTTGTGGTGG + Intergenic
1067397757 10:45938339-45938361 ATTGGTCCTTTTATATGAGGGGG - Intergenic
1067866078 10:49907433-49907455 ATTGGTCCTTTTATATGAGGGGG - Intronic
1070263496 10:74880618-74880640 ACTGATGTTTTTTTTTGAGATGG + Intronic
1070280926 10:75047787-75047809 ACAGGTGATTTTTTTGGAGGGGG - Intronic
1073368936 10:102969216-102969238 AGTAGTGCTTTTTTTTGAGGCGG + Intronic
1073668132 10:105556452-105556474 ACTGGTGCCCTTTTAAGAAGAGG - Intergenic
1074268753 10:111931530-111931552 AGTGGTGCTCTTTTAAAAGGGGG - Intergenic
1074501999 10:114034115-114034137 AGTGGTGCTTTGTTCTGTGGTGG + Intergenic
1075653208 10:124143607-124143629 ACTGGTGGCTTTTTAAGAAGAGG - Intergenic
1079671184 11:23173353-23173375 GCTGGTGCTTATTCATGAGCAGG - Intergenic
1080375512 11:31705285-31705307 ACTGGTGGCTTTATAAGAGGAGG - Intronic
1081108845 11:39106740-39106762 ACTGGTGCTTTTGTAAAAAGAGG - Intergenic
1082265436 11:50112803-50112825 TCTTGTGCTTTTTTTGGAGGGGG - Intergenic
1084877153 11:72141636-72141658 ACTGGAGCTCATTTATGGGGTGG - Intergenic
1084882314 11:72180439-72180461 ACTGGAGCTCATTTATGGGGTGG - Intergenic
1085872471 11:80366939-80366961 AGTGGTGCTTGGTTATGAGTCGG + Intergenic
1087566789 11:99870007-99870029 AGTGGTGCCTTTTAATTAGGTGG - Intronic
1087848513 11:103000887-103000909 ACTGGTGCTTTTTTAAGTAGAGG + Intergenic
1088858970 11:113782034-113782056 ATTGGGGCTATTTTATCAGGAGG - Intergenic
1093999748 12:25682432-25682454 ACTGGTGCTTTAGTGTGAGGAGG + Intergenic
1094225170 12:28037225-28037247 ACTGGTGCTCTTACATGAAGAGG - Intergenic
1094400303 12:30055921-30055943 ACTGGTGCGTTTTTACGGAGTGG + Intergenic
1094730761 12:33172034-33172056 GCTGGTGTTTTTTTGTGTGGGGG - Intergenic
1095125292 12:38470061-38470083 ACTGGCAATTTTTTTTGAGGGGG - Intergenic
1095143106 12:38691159-38691181 ACAGGTGCTTTTATAAGATGGGG + Intronic
1096978671 12:55716144-55716166 CCTGGTGTTCTTTTAGGAGGCGG - Exonic
1097296451 12:57969058-57969080 ACAGATTCTTTTTTATTAGGTGG + Intergenic
1097825801 12:64173530-64173552 ACTGGTGTTCTTTTAAGAAGAGG + Intergenic
1098271626 12:68775505-68775527 ACTGGTGCCTTTATAAGAAGAGG - Exonic
1099800056 12:87445358-87445380 AGTGGTGTTTTTTTCTGGGGAGG - Intergenic
1100218959 12:92483082-92483104 ACTGGTGTTCTTATATGAAGAGG + Intergenic
1100297317 12:93275053-93275075 ACTGGTGTTTTTATTTGAAGAGG + Intergenic
1100310530 12:93390896-93390918 AATGCTGCTTTTCTAAGAGGAGG + Intronic
1103728605 12:123011632-123011654 ACTGGTGTTTTTATAAGAAGAGG + Intronic
1105755854 13:23463629-23463651 ACTGGTGATTTTCTAAGACGAGG + Intergenic
1106012514 13:25838278-25838300 ACAGCTGCTTTTTTCTGGGGAGG + Intronic
1106814113 13:33388073-33388095 AATGGTGCCTTTCTATAAGGTGG + Intergenic
1106906083 13:34410280-34410302 ACTTGTTCTTTTTTTTGAAGAGG - Intergenic
1107523495 13:41206203-41206225 ACTGGTGGCTTTATATGAAGAGG + Intergenic
1107888932 13:44897081-44897103 ACTGGTGTTTTTGAAAGAGGTGG - Intergenic
1108432384 13:50367325-50367347 ACTGGTGCCTTTATAGGAAGGGG + Intronic
1108780694 13:53827685-53827707 TCTGGAACTTTTTTATGATGAGG + Intergenic
1108877565 13:55065720-55065742 ACTGGTGTTCTTATAAGAGGAGG - Intergenic
1110100753 13:71598257-71598279 ATTGATGCTTTTTTTTGAGATGG + Intronic
1110476179 13:75916626-75916648 ACTGCTGCTCTTATATGAAGAGG + Intergenic
1113058790 13:106298939-106298961 ACTGGTGCTCTTATAAGAAGAGG + Intergenic
1113122881 13:106943219-106943241 ATTGGTTCTCTTTTATGAGGTGG + Intergenic
1114725258 14:24929931-24929953 AGTGGTGCTTTGTGATGGGGAGG - Intronic
1114955151 14:27808140-27808162 ACTGGTGTCCTTTTATGAAGAGG - Intergenic
1116223632 14:42119397-42119419 ACTGTAGCTTTTTTATGGGGGGG - Intergenic
1117286128 14:54287436-54287458 AATGGTGCTTTTGGAGGAGGAGG - Intergenic
1118481626 14:66173359-66173381 ACTGGGGCTTGTTGATGGGGAGG - Intergenic
1120255642 14:82115929-82115951 ACTGGTGGTTTTATAGGAAGAGG + Intergenic
1120652372 14:87150283-87150305 ACTGGTGACTGTTTGTGAGGAGG - Intergenic
1120918083 14:89727654-89727676 ACTGGTGCCCTTTTAAGAAGAGG + Intergenic
1127007475 15:54586484-54586506 ACTGGTGTCCTTTTAAGAGGAGG - Intronic
1127411583 15:58712819-58712841 TCTTGTTCTTTTTTTTGAGGCGG - Intronic
1129030552 15:72614877-72614899 CCTGGTGCTTTATTCTAAGGCGG + Intergenic
1129108579 15:73324583-73324605 ATTAGTGCCTTTTTAGGAGGAGG + Intronic
1129209672 15:74060423-74060445 CCTGGTGCTTTATTCTAAGGTGG - Intergenic
1129477395 15:75795390-75795412 CCTGGTGCTTTATTCTAAGGCGG + Intergenic
1130647351 15:85740892-85740914 CCTGGAGCATTTTTATGAGACGG + Intronic
1132955909 16:2593386-2593408 CCTGGTGGTTTTTTAGGTGGAGG + Intronic
1133836209 16:9369744-9369766 ACTGGTGCTTTTATAAGAAGTGG + Intergenic
1136330914 16:29575880-29575902 AGTGTTGCTTGTTTATGGGGGGG - Intergenic
1137375461 16:47948264-47948286 ACCTGGGCTTTTTTTTGAGGGGG + Intergenic
1137421927 16:48342158-48342180 ACTGAGGCTTTTATATGAGGTGG - Intronic
1137519533 16:49180185-49180207 AGTGCTGCTGTTTTTTGAGGTGG - Intergenic
1137974543 16:53020259-53020281 ACTTGTCCTTTGTAATGAGGTGG - Intergenic
1139527246 16:67524630-67524652 AATGGTGTTTTTTAATGAGGTGG - Intronic
1139803045 16:69539911-69539933 ACTGGTGGTTTTATAAGAAGAGG - Intergenic
1140129853 16:72150811-72150833 ACAGGTGATTCTCTATGAGGAGG - Exonic
1140588323 16:76321439-76321461 GTAGGTGCTTTTTTATGAGTTGG + Intronic
1140921890 16:79546216-79546238 ACTGGGGTTATTTTATAAGGTGG - Intergenic
1142878018 17:2864050-2864072 ACTGTTTTTTTTTTTTGAGGGGG - Intronic
1143557216 17:7669418-7669440 ACTGGTGTTTTGTTGTGGGGAGG - Exonic
1143846451 17:9775889-9775911 ACTGGTGCTATTGTAAGAAGAGG + Intronic
1146106095 17:30038889-30038911 TCTGGTCCTTTCTCATGAGGAGG + Intronic
1146364529 17:32210857-32210879 ACTTTTGCTTTTTTTGGAGGGGG - Intronic
1151061609 17:71101033-71101055 ACTCGTACATTATTATGAGGTGG + Intergenic
1155416550 18:25605361-25605383 GCTGTTGCTTTTTTATTTGGGGG - Intergenic
1155490620 18:26398023-26398045 ACTGGTGTTTTTATAAGAGGAGG - Intergenic
1156279428 18:35620515-35620537 ACTAGTGGTTGTTTCTGAGGAGG - Intronic
1157883132 18:51341115-51341137 ACTGGTGTTTTTTTCTGGGGGGG + Intergenic
1157883181 18:51341421-51341443 ACTGGTGTTCTTATATGAAGAGG + Intergenic
1159018327 18:63121295-63121317 ATTTGTGCATTTTTATGAGTTGG - Intergenic
1159137434 18:64352620-64352642 ACTGTGCCTATTTTATGAGGTGG + Intergenic
1159462846 18:68742310-68742332 ACTGGTGCTCTTATAGGAAGAGG - Intronic
1161914874 19:7220969-7220991 ACTGGTGGTTTTATAAGAAGAGG + Intronic
1163012427 19:14434013-14434035 GCTGGAGCTTTGTTATGCGGGGG - Intronic
1165580014 19:36854302-36854324 ACAGCTGCTTTTTGAGGAGGAGG - Intronic
1165919201 19:39282848-39282870 ACTGTTTCTTTTTTTTGAGATGG - Intergenic
1166968867 19:46548659-46548681 AATGGTGCTTCTTTGTGATGGGG - Intronic
1168654851 19:58119644-58119666 ACTTTTCCTTGTTTATGAGGGGG + Intergenic
925579037 2:5391404-5391426 ACTGTTGCTTTTTTAAAAAGCGG + Intergenic
925628773 2:5867900-5867922 TCTGGTGCTTTTCTATGTGAGGG - Intergenic
926438219 2:12859182-12859204 ACTGGTGCCTTTATAAGAAGAGG - Intergenic
928761675 2:34590722-34590744 ACTGATCTTTTTTTTTGAGGGGG - Intergenic
932003744 2:67907501-67907523 ACTGGTGCTTTCCTATGAATTGG + Intergenic
932224816 2:70031170-70031192 ACTGGTTTTTTTCTATGAGGAGG + Intergenic
932276851 2:70458186-70458208 ACTGGCCCTTTCCTATGAGGCGG + Intronic
932431301 2:71675292-71675314 AGTGGTGCATTTATGTGAGGTGG + Intronic
933245603 2:79971393-79971415 AATGGTGTTTTTCTCTGAGGCGG + Intronic
934744995 2:96753524-96753546 ACTGGGGCTTTTATACAAGGAGG - Intergenic
935650971 2:105381812-105381834 CCTGGTGCTTTTTTATTTGTTGG - Intronic
937417152 2:121724554-121724576 TCTGATGCTTTCTTATGAGTTGG + Intergenic
937808240 2:126170472-126170494 TCTGGTTCTTTTATTTGAGGTGG + Intergenic
938553242 2:132399961-132399983 ACTGGTGCCTTTATAAGAAGAGG - Intergenic
938679158 2:133671512-133671534 ACTGGTGGTTTTATAAGAAGAGG + Intergenic
938679949 2:133679252-133679274 ACTGGTGTTTTTATAAGAAGAGG - Intergenic
940320528 2:152371801-152371823 ACTGGTGGTTTTCTAGGAAGAGG + Intronic
940922891 2:159329178-159329200 ATTGTTGTTTTGTTATGAGGGGG - Intronic
940952622 2:159693310-159693332 ACTGGTGCTTTTTTATGAGGTGG + Intergenic
940982637 2:160020604-160020626 ACTGGTGGCTTTATAAGAGGAGG + Intronic
941005824 2:160245994-160246016 AATGGTGCTTTTATGGGAGGGGG + Intronic
941205399 2:162566166-162566188 ACAGATGCTTTTTTTTGAGGAGG - Intronic
943161044 2:184251716-184251738 AATTGTGCTTTTAGATGAGGTGG - Intergenic
944464115 2:199983098-199983120 ACTGGTGATGTTTTAAGAAGAGG + Intronic
945510575 2:210697339-210697361 ATTGGTGCTTTTTGTTGAGAAGG + Intergenic
945982347 2:216322818-216322840 ACCGGTTCTTTTTTTTGAGACGG - Intronic
946823442 2:223653298-223653320 AGTGGAGCATTTTTATGTGGGGG - Intergenic
947562487 2:231169172-231169194 ACTGTTGTTTTTGTATGATGAGG + Intronic
1169087357 20:2835703-2835725 ACTGGTTCTTTTGTAGGATGTGG - Exonic
1169472095 20:5895329-5895351 ACTGGTGTTTTTATATGAAGAGG - Intergenic
1171846124 20:30275994-30276016 AGTGGCTCCTTTTTATGAGGAGG - Intergenic
1173549230 20:43920861-43920883 AATGGTGCTTTTTGAGGAGATGG + Intronic
1175840557 20:62024070-62024092 ACTGGAGCTTTTTTTAGACGGGG - Intronic
1176930772 21:14807290-14807312 ACTGGTGATTTTATAAGAGAAGG + Intergenic
1177353357 21:19974373-19974395 ACTGTTGTTTTTATATGAGTAGG - Intergenic
1178144586 21:29724234-29724256 ACTGATTCATTTTTATGATGTGG + Intronic
1179330010 21:40390748-40390770 ACTGGTGTTTTTGTAAGAAGAGG - Intronic
1180608520 22:17080153-17080175 ACTGGTGTCTTTATATGAAGAGG - Intergenic
1180857560 22:19058041-19058063 ACTGCTGCTGTCTTAGGAGGGGG - Intronic
1183946349 22:41328220-41328242 ACTGGTACTTACTCATGAGGAGG + Intronic
949780599 3:7682721-7682743 ACTGTTGCTATTTAATGATGAGG + Intronic
951357075 3:21680588-21680610 ACTGATGCTTTTTTATCAAAAGG + Intronic
952661829 3:35860151-35860173 AATGTTGCTTTTTTATGGAGGGG + Intergenic
953117739 3:40009545-40009567 ACTGCTACTTTTTAATGTGGAGG + Intronic
954057118 3:48035941-48035963 ACTGCTGTTTTTTTTTGAGAGGG - Intronic
954331403 3:49892524-49892546 TCTGCTGCTTTTCTTTGAGGGGG - Intronic
955459296 3:59163176-59163198 TCTGGTGCATTTTTCTGAAGTGG + Intergenic
960579163 3:119259551-119259573 ACTGGTGACTTTATAAGAGGAGG + Intergenic
962073599 3:132057146-132057168 ACAGGTGCTGTTTTCTAAGGTGG - Intronic
962092236 3:132256535-132256557 AATTTTCCTTTTTTATGAGGAGG - Intronic
962228397 3:133636269-133636291 AGTGGTGAGTTTTTTTGAGGGGG + Intronic
963441728 3:145348409-145348431 GCTGCTGCTGTTTTATGAGCAGG - Intergenic
965006609 3:163034595-163034617 ACTGGTGTCTTTATATGAAGAGG - Intergenic
966409676 3:179635236-179635258 ACTGGTCCCCTTTTATGAAGAGG + Intergenic
966468083 3:180255052-180255074 ACTGGTGGTTTTCAATGAGGAGG - Intergenic
967371589 3:188752684-188752706 ACTGGAACTTTAATATGAGGCGG - Intronic
969293723 4:6256804-6256826 ACTGGTGCCCTTTTAAGAAGAGG + Intergenic
970316997 4:14838760-14838782 ACTGGTGTCTTTATAAGAGGAGG + Intergenic
970464928 4:16312826-16312848 ACTGGTGTTTTTCTAAGAAGAGG - Intergenic
970936088 4:21571509-21571531 CCTGCTGCTTATTTATGTGGAGG - Intronic
975555010 4:75653990-75654012 ACTGGTGCTTTAACATGGGGTGG + Exonic
976473219 4:85453828-85453850 ACTGATTCTTTTTTCTCAGGGGG - Intergenic
977207595 4:94180930-94180952 ACTGTTGCTTTTTTAATATGAGG + Intergenic
978957788 4:114635683-114635705 AATGGATCTTTTTTATGAGGGGG - Intronic
979378427 4:119977673-119977695 TCTGGTGCTTTCTTAAGAAGGGG - Intergenic
979704314 4:123703367-123703389 ACTGGTGTTCTTGTATGAAGAGG + Intergenic
981216083 4:142169854-142169876 AATAGTGCTTTTTGATGAGCAGG + Intronic
981249923 4:142587450-142587472 ACTGGTACTTTTTTTTCAGAAGG - Intronic
981452908 4:144919987-144920009 ACTGGTATCTTTTTAAGAGGGGG + Intergenic
985585458 5:730798-730820 ACTGGTGTCCTTTTATGAAGGGG + Intronic
985598970 5:815121-815143 ACTGGTGTCCTTTTATGAAGGGG + Intronic
985599895 5:822225-822247 ACTGGTGTCCTTTTATGAAGGGG + Intronic
986494493 5:8328919-8328941 ACTGCTGCTTTTTGTTGAGGTGG + Intergenic
987371315 5:17195886-17195908 ACTGTTGCTTTTTTTTGAGATGG + Intronic
987449351 5:18062616-18062638 ACTGGTGTTTTTATAAGAAGAGG + Intergenic
987470352 5:18320412-18320434 ACTGATGCTTTGCTATAAGGGGG + Intergenic
989615861 5:43336058-43336080 TCTGGTTCTCTTTCATGAGGAGG - Intergenic
990625243 5:57603257-57603279 ACTTATGTTTTTTTCTGAGGGGG + Intergenic
990958984 5:61373303-61373325 ACTGGGTCTTTTTTTGGAGGGGG + Intronic
992191383 5:74295341-74295363 ACTGGTGATCTTTTAAGAAGAGG + Intergenic
993802122 5:92355060-92355082 AGTGGTGCCGTTTTATGAGTAGG + Intergenic
994379338 5:99052914-99052936 ACTGGTGGCTTTCTAAGAGGAGG + Intergenic
994606286 5:101971289-101971311 ACTGGTGCTTGTTGGTGGGGTGG - Intergenic
995557399 5:113343935-113343957 GATGGTGCTTTTTTATGTGTAGG - Intronic
995920671 5:117306765-117306787 ATTGGTGCTATATTATGAGAGGG - Intergenic
997323771 5:133002722-133002744 ACTTTTTCTTTTTTTTGAGGTGG + Intronic
997757028 5:136408987-136409009 AGTGGTGCATTTGTATTAGGTGG + Intergenic
999142073 5:149368825-149368847 GCTGCTGCTTTTTTTTAAGGGGG + Exonic
999617785 5:153443398-153443420 ACTGGTGGTTTTATAAGATGAGG - Intergenic
1000561303 5:162792427-162792449 ACTTGTGTTTTTCTAAGAGGAGG - Intergenic
1000581499 5:163040053-163040075 TCTGATGGTTTTTTATAAGGGGG + Intergenic
1002926200 6:1606989-1607011 CCTGGTGCTTTTCTATGGTGGGG + Intergenic
1003826803 6:9961769-9961791 ACTGGTGAGTTTTTGTGAAGTGG + Intronic
1003882226 6:10489232-10489254 ACTGGTGTTTTTCTAAGAAGAGG - Intergenic
1005530171 6:26696404-26696426 ACTGTTGATTTTTTTTGGGGGGG - Intergenic
1005540625 6:26805243-26805265 ACTGTTGATTTTTTTTGGGGGGG + Intergenic
1006196626 6:32246941-32246963 TCTGGTACTTTTTTTTGAGATGG + Intergenic
1008195794 6:48518376-48518398 ACTGGCGCTTTTTTATCTAGGGG + Intergenic
1008335263 6:50296537-50296559 ACAGGTCTATTTTTATGAGGTGG + Intergenic
1009011438 6:57847339-57847361 ACTGTTGATTTTTTTTGGGGGGG + Intergenic
1009237892 6:61146788-61146810 AATGGTGTATTTTTATGTGGGGG - Intergenic
1010051092 6:71505208-71505230 ACTGGTGCTTATTTCTCAGCCGG + Intergenic
1010189384 6:73179366-73179388 ACTGGTGGTTTTATAAGAAGTGG - Intronic
1010981301 6:82373318-82373340 ACTGTTGTTTTTTTCTGGGGAGG + Intergenic
1011436574 6:87344438-87344460 ACTGGTGGTTTTATAAGAAGAGG + Intronic
1012307624 6:97678038-97678060 ACTGGTAATATTTTATGATGAGG + Intergenic
1013004238 6:106056621-106056643 ACTTGTGCTTTTTAATTAGAAGG + Intergenic
1015285920 6:131486119-131486141 ATTGGTCCTTTTTTGTCAGGGGG + Intergenic
1015416999 6:132960879-132960901 AGTGGTGGTTTCTTATGATGCGG - Intergenic
1015906892 6:138126828-138126850 ATTTCTGCTTTTTTAGGAGGAGG + Intergenic
1016848448 6:148592434-148592456 CCTGGTGCTCTTTTAAGAAGAGG + Intergenic
1018323421 6:162637278-162637300 GCTGCTGCTTTTTTTTGGGGGGG - Intronic
1018535734 6:164817615-164817637 ACTGGTGCTTTATCATGCTGTGG - Intergenic
1018685990 6:166305278-166305300 ACTTGTGATTCTTTTTGAGGGGG - Exonic
1018833347 6:167463209-167463231 ACTGGTGTTTTTATCTGAAGAGG - Intergenic
1019890129 7:3939950-3939972 ACTGGTGGTTTTTCATGGGCTGG - Intronic
1020726908 7:11827221-11827243 AATGTTGTTGTTTTATGAGGAGG - Intronic
1021149236 7:17129113-17129135 ACTGGTGCCTTTATAAGAAGAGG + Intergenic
1022317687 7:29260773-29260795 ACCGGACCTGTTTTATGAGGTGG + Intronic
1022339374 7:29453978-29454000 ACTGGGCCATTTATATGAGGTGG - Intronic
1022617865 7:31951105-31951127 ACTGGTGTCTTTTTAAGAAGAGG - Intronic
1024264880 7:47598845-47598867 ACTGGGGCTTGTTTAGGGGGAGG - Intergenic
1025796868 7:64746171-64746193 ACTGGTTTTTTTTTGTGGGGGGG + Intergenic
1026040828 7:66866349-66866371 TCTTGTGCTTTTTTTGGAGGGGG + Intergenic
1026083442 7:67242394-67242416 ACTGGGTCTTTTTTTTGAGATGG + Intergenic
1026148519 7:67768980-67769002 ACAGGGGCTTTTTTCTGAGAGGG - Intergenic
1026564799 7:71481067-71481089 ACTGGTGCATTTTTCCCAGGAGG + Intronic
1026693604 7:72571635-72571657 ACTGGGTCTTTTTTTTGAGATGG - Intronic
1027454403 7:78370606-78370628 ATTAGTACTTTTTTATGAGTTGG - Intronic
1028246579 7:88486698-88486720 ACTGGTGCTCTTATAAGAGGAGG + Intergenic
1028827282 7:95288317-95288339 AATGGTGCTTTTTTATTATGGGG + Intronic
1030212785 7:107012843-107012865 ACTGTTACTTTTTTTTGAGATGG + Intergenic
1030657938 7:112188822-112188844 AATGCTGCTTTTATATGATGAGG - Intronic
1031980844 7:128123341-128123363 ACTGGTGCTCTTTTAGAAGAGGG - Intergenic
1032892646 7:136215867-136215889 ACTGGTGGCTTTTTAAGAAGAGG - Intergenic
1033103960 7:138501881-138501903 ACTGGTTTTTTTTTTTGAGACGG - Intronic
1033203788 7:139398480-139398502 ACAGATGCTTTTTTATGTAGGGG - Intronic
1034582267 7:152055106-152055128 ACTGGTGTCTTTATAAGAGGAGG - Intronic
1036415906 8:8548198-8548220 ACTGTTACTTTTTTATTATGAGG - Intergenic
1036458028 8:8926581-8926603 ACTGTTTTTTTTTTTTGAGGCGG - Intergenic
1037952376 8:23027747-23027769 ACTGCTTCTTTTTTAGGTGGTGG - Exonic
1038208711 8:25494820-25494842 ACTGGTGTTCTTATAAGAGGAGG + Intronic
1038409559 8:27347614-27347636 GCTGGTGCCTTTATAAGAGGAGG - Intronic
1038431841 8:27506796-27506818 ACAGGGGCTATTTTATGATGAGG - Intronic
1039376847 8:37043307-37043329 ACTGGTGGTTTTATAAGAAGAGG + Intergenic
1040426355 8:47291036-47291058 ACTGGTGCTTTTAGATGTGGTGG - Exonic
1041260963 8:56020202-56020224 ACTGGTGCTGTTATAAGAAGAGG - Intergenic
1041735856 8:61109783-61109805 ACTGGTGGTTTTATAAGAAGAGG + Intronic
1042518166 8:69681587-69681609 ACTGTTTCTTTTTTTTGAGATGG - Intronic
1042867488 8:73368554-73368576 ACTGGTGGCTTTATAAGAGGAGG - Intergenic
1044492012 8:92830521-92830543 TATGGTGCTTTTTTAGGGGGTGG + Intergenic
1044860312 8:96516542-96516564 ACAGGTTTTTTTTTTTGAGGTGG - Intronic
1045013485 8:97978710-97978732 ACTCCTGATTTTTTTTGAGGGGG + Intronic
1045023213 8:98062391-98062413 ACTGGTGTTCTTATAAGAGGGGG + Intergenic
1046288546 8:112128505-112128527 ACTGGTGGTTTTAGATGAAGAGG + Intergenic
1047599681 8:126413623-126413645 ACTGGTGCTCTTATAAGAAGAGG - Intergenic
1048498958 8:134958541-134958563 ACTGGAGCTTTTTTTTGAGATGG - Intergenic
1050875500 9:10629894-10629916 ACTGGTGCCTTCTATTGAGGAGG - Intergenic
1050882680 9:10722510-10722532 ACTGGTGCTCTGTAATGAGAAGG - Intergenic
1054805357 9:69391881-69391903 AGTGCTCCTTTTTTTTGAGGTGG - Exonic
1056257178 9:84811926-84811948 CCTGTTCCTTTTTTATCAGGAGG + Intronic
1056382542 9:86068110-86068132 ACTGGTGTTCTTATAAGAGGAGG + Intronic
1057452158 9:95174303-95174325 ACTGGTGATTTTATAAGAGGTGG - Intronic
1059627316 9:116080997-116081019 ACTGGTGTTTTTATAAGAAGAGG - Intergenic
1060337497 9:122739492-122739514 ACTGGTGGCTTTTTAAGAAGAGG - Intergenic
1062618611 9:137409170-137409192 ACTGGTGGCTTTATAAGAGGAGG + Intronic
1186288741 X:8073177-8073199 CCTGGGGCTTTTCCATGAGGAGG + Intergenic
1186734546 X:12447394-12447416 ACTGGTGATTCTTAATGAGGGGG - Intronic
1187692447 X:21883338-21883360 GCTAGTGCTGCTTTATGAGGGGG - Exonic
1190821818 X:53980333-53980355 ACTGGTGGTCTTATAAGAGGTGG + Intronic
1190942833 X:55059323-55059345 ACTGATGCTTTTATAAGAAGAGG - Intergenic
1193368185 X:80659674-80659696 ACTGGTGGCTTTTTAAGAAGAGG + Intergenic
1194102686 X:89726314-89726336 ACTGGTGCTTTTTGTTTTGGAGG + Intergenic
1195704679 X:107730298-107730320 AGTTGTGCTTTGTTTTGAGGAGG + Intronic
1196613068 X:117735891-117735913 ACTGTTGCGTGTTTATGGGGTGG + Intergenic
1197681031 X:129385461-129385483 ACTGGGACTTTTTTTGGAGGGGG - Intergenic
1199346811 X:146750245-146750267 ACTGGTGTTCTTATATGAAGAGG - Intergenic
1199408796 X:147494868-147494890 CCCTGTGCTTTTTTAGGAGGTGG - Intergenic
1200455362 Y:3384306-3384328 ACTGGTGCTTTTTGTTTTGGAGG + Intergenic
1201381488 Y:13384846-13384868 ACTGTTTCTTTTTTTTGAGATGG + Intronic