ID: 940954420

View in Genome Browser
Species Human (GRCh38)
Location 2:159712393-159712415
Sequence TCCAGCCCGCCCGCAGCTCT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 203}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940954409_940954420 12 Left 940954409 2:159712358-159712380 CCCGCAGTCAGAGCACCACCCCG 0: 1
1: 0
2: 0
3: 15
4: 142
Right 940954420 2:159712393-159712415 TCCAGCCCGCCCGCAGCTCTCGG 0: 1
1: 0
2: 1
3: 16
4: 203
940954415_940954420 -3 Left 940954415 2:159712373-159712395 CCACCCCGCGGTGGGGTACCTCC 0: 1
1: 0
2: 0
3: 5
4: 39
Right 940954420 2:159712393-159712415 TCCAGCCCGCCCGCAGCTCTCGG 0: 1
1: 0
2: 1
3: 16
4: 203
940954410_940954420 11 Left 940954410 2:159712359-159712381 CCGCAGTCAGAGCACCACCCCGC 0: 1
1: 0
2: 0
3: 9
4: 115
Right 940954420 2:159712393-159712415 TCCAGCCCGCCCGCAGCTCTCGG 0: 1
1: 0
2: 1
3: 16
4: 203
940954418_940954420 -8 Left 940954418 2:159712378-159712400 CCGCGGTGGGGTACCTCCAGCCC 0: 1
1: 0
2: 4
3: 8
4: 100
Right 940954420 2:159712393-159712415 TCCAGCCCGCCCGCAGCTCTCGG 0: 1
1: 0
2: 1
3: 16
4: 203
940954416_940954420 -6 Left 940954416 2:159712376-159712398 CCCCGCGGTGGGGTACCTCCAGC 0: 1
1: 0
2: 0
3: 2
4: 98
Right 940954420 2:159712393-159712415 TCCAGCCCGCCCGCAGCTCTCGG 0: 1
1: 0
2: 1
3: 16
4: 203
940954417_940954420 -7 Left 940954417 2:159712377-159712399 CCCGCGGTGGGGTACCTCCAGCC 0: 1
1: 0
2: 0
3: 9
4: 89
Right 940954420 2:159712393-159712415 TCCAGCCCGCCCGCAGCTCTCGG 0: 1
1: 0
2: 1
3: 16
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940954420 Original CRISPR TCCAGCCCGCCCGCAGCTCT CGG Intergenic