ID: 940956403

View in Genome Browser
Species Human (GRCh38)
Location 2:159732861-159732883
Sequence TGAAATGGTGATAGTGATAG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940956399_940956403 21 Left 940956399 2:159732817-159732839 CCATCATGCCTGGCCTGTATTTT No data
Right 940956403 2:159732861-159732883 TGAAATGGTGATAGTGATAGCGG No data
940956400_940956403 13 Left 940956400 2:159732825-159732847 CCTGGCCTGTATTTTATTTATCT No data
Right 940956403 2:159732861-159732883 TGAAATGGTGATAGTGATAGCGG No data
940956401_940956403 8 Left 940956401 2:159732830-159732852 CCTGTATTTTATTTATCTGTATT No data
Right 940956403 2:159732861-159732883 TGAAATGGTGATAGTGATAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940956403 Original CRISPR TGAAATGGTGATAGTGATAG CGG Intronic
No off target data available for this crispr