ID: 940962153

View in Genome Browser
Species Human (GRCh38)
Location 2:159797964-159797986
Sequence CCCCCGTGGGTCCTGGCTCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 334
Summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 298}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940962153_940962166 0 Left 940962153 2:159797964-159797986 CCCGGAGCCAGGACCCACGGGGG 0: 1
1: 0
2: 2
3: 33
4: 298
Right 940962166 2:159797987-159798009 ACGGGCGTGCAGGGAAGGGCGGG 0: 1
1: 0
2: 0
3: 21
4: 372
940962153_940962172 27 Left 940962153 2:159797964-159797986 CCCGGAGCCAGGACCCACGGGGG 0: 1
1: 0
2: 2
3: 33
4: 298
Right 940962172 2:159798014-159798036 CCGGCCGGGTGTTGCGTCTGCGG 0: 1
1: 0
2: 0
3: 2
4: 56
940962153_940962163 -5 Left 940962153 2:159797964-159797986 CCCGGAGCCAGGACCCACGGGGG 0: 1
1: 0
2: 2
3: 33
4: 298
Right 940962163 2:159797982-159798004 GGGGGACGGGCGTGCAGGGAAGG 0: 1
1: 0
2: 3
3: 84
4: 710
940962153_940962168 8 Left 940962153 2:159797964-159797986 CCCGGAGCCAGGACCCACGGGGG 0: 1
1: 0
2: 2
3: 33
4: 298
Right 940962168 2:159797995-159798017 GCAGGGAAGGGCGGGATGGCCGG 0: 1
1: 0
2: 1
3: 67
4: 1050
940962153_940962164 -4 Left 940962153 2:159797964-159797986 CCCGGAGCCAGGACCCACGGGGG 0: 1
1: 0
2: 2
3: 33
4: 298
Right 940962164 2:159797983-159798005 GGGGACGGGCGTGCAGGGAAGGG 0: 1
1: 0
2: 4
3: 63
4: 1159
940962153_940962170 13 Left 940962153 2:159797964-159797986 CCCGGAGCCAGGACCCACGGGGG 0: 1
1: 0
2: 2
3: 33
4: 298
Right 940962170 2:159798000-159798022 GAAGGGCGGGATGGCCGGCCGGG 0: 1
1: 0
2: 1
3: 11
4: 294
940962153_940962173 28 Left 940962153 2:159797964-159797986 CCCGGAGCCAGGACCCACGGGGG 0: 1
1: 0
2: 2
3: 33
4: 298
Right 940962173 2:159798015-159798037 CGGCCGGGTGTTGCGTCTGCGGG 0: 1
1: 0
2: 0
3: 3
4: 45
940962153_940962160 -10 Left 940962153 2:159797964-159797986 CCCGGAGCCAGGACCCACGGGGG 0: 1
1: 0
2: 2
3: 33
4: 298
Right 940962160 2:159797977-159797999 CCCACGGGGGACGGGCGTGCAGG 0: 1
1: 0
2: 1
3: 7
4: 142
940962153_940962165 -1 Left 940962153 2:159797964-159797986 CCCGGAGCCAGGACCCACGGGGG 0: 1
1: 0
2: 2
3: 33
4: 298
Right 940962165 2:159797986-159798008 GACGGGCGTGCAGGGAAGGGCGG 0: 1
1: 0
2: 0
3: 23
4: 375
940962153_940962162 -9 Left 940962153 2:159797964-159797986 CCCGGAGCCAGGACCCACGGGGG 0: 1
1: 0
2: 2
3: 33
4: 298
Right 940962162 2:159797978-159798000 CCACGGGGGACGGGCGTGCAGGG 0: 1
1: 0
2: 0
3: 8
4: 107
940962153_940962169 12 Left 940962153 2:159797964-159797986 CCCGGAGCCAGGACCCACGGGGG 0: 1
1: 0
2: 2
3: 33
4: 298
Right 940962169 2:159797999-159798021 GGAAGGGCGGGATGGCCGGCCGG 0: 1
1: 0
2: 0
3: 28
4: 537
940962153_940962167 4 Left 940962153 2:159797964-159797986 CCCGGAGCCAGGACCCACGGGGG 0: 1
1: 0
2: 2
3: 33
4: 298
Right 940962167 2:159797991-159798013 GCGTGCAGGGAAGGGCGGGATGG 0: 1
1: 0
2: 3
3: 44
4: 556

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940962153 Original CRISPR CCCCCGTGGGTCCTGGCTCC GGG (reversed) Intronic
900298637 1:1965568-1965590 TCTGCGTGGGTCCTGGCTCTGGG + Intronic
900408506 1:2502695-2502717 CCCCCAAGGGTCCTGGGGCCTGG + Intronic
900420639 1:2554605-2554627 CCCCCTTGAGGCCTGGCACCTGG + Intergenic
900502375 1:3012708-3012730 CCCGCCTGGGTCTGGGCTCCTGG + Intergenic
900507984 1:3039183-3039205 CCGCAGGGGGTCCTGGCTGCAGG - Intergenic
900622943 1:3595738-3595760 CCGACGGTGGTCCTGGCTCCAGG + Intronic
901630091 1:10643706-10643728 GCCCCGTGGGTGCTGGGGCCTGG - Intronic
902364356 1:15961761-15961783 CCCAAGTGTGACCTGGCTCCTGG + Intronic
903270119 1:22182988-22183010 CTCATGTTGGTCCTGGCTCCGGG + Intergenic
903493012 1:23743675-23743697 GCCCCGCGGGGCCTGGCTCAGGG - Intronic
904330842 1:29757027-29757049 CCCCCCTGGGCCCTGGACCCAGG - Intergenic
904420220 1:30386326-30386348 GCCACGTGGGTCCTGGCTCTGGG + Intergenic
905334004 1:37231806-37231828 CCTCTGTGGATCCAGGCTCCAGG - Intergenic
905909296 1:41642853-41642875 CCCCTAGGGGTCCTGGCCCCTGG - Intronic
911390298 1:97233131-97233153 CACCCGAGGGGCATGGCTCCTGG + Intronic
911822073 1:102435573-102435595 CCTCTGTGGTTCCTGGGTCCTGG - Intergenic
913324701 1:117616541-117616563 CACCTGTGGGCCCTGGCTCCTGG - Intronic
914672111 1:149878806-149878828 CTCCCGTGAGTCCTGGCCCCTGG + Intronic
914742036 1:150472978-150473000 CCCCCGTGGTCCCTGGGTCCTGG - Exonic
920209435 1:204317252-204317274 CAGCCCTGGGTCCTAGCTCCAGG + Intronic
921232144 1:213083741-213083763 CCCCAGTGGTCCCTGTCTCCTGG + Intronic
922182030 1:223243109-223243131 GCCCTGTGGCTCCAGGCTCCAGG + Intronic
924433896 1:244021835-244021857 CCCCTGTGCCTCCTGGGTCCTGG - Intergenic
924718660 1:246602689-246602711 CCCCCGTGATTCCTGCCTCTTGG - Intronic
1064888037 10:20134733-20134755 CCCCCATGGCTCCAGGCTCCAGG - Intronic
1065614308 10:27504485-27504507 CCCCGGTGGCTGCTGTCTCCTGG + Intronic
1065704961 10:28464262-28464284 GCCAAGTGGATCCTGGCTCCAGG - Intergenic
1067805129 10:49386780-49386802 GCTCCTTGGCTCCTGGCTCCTGG + Exonic
1070504805 10:77103798-77103820 CCCCTAAGGGTCCTGGCCCCAGG - Intronic
1070529604 10:77325263-77325285 CCACAGTGAGTCCAGGCTCCTGG + Intronic
1070811039 10:79298292-79298314 CTCCCGAGGGGCATGGCTCCAGG + Intronic
1072825290 10:98599529-98599551 CCCCCATGGGACCAGACTCCAGG - Intronic
1072878935 10:99204239-99204261 CCCCAGTAGATCCAGGCTCCAGG + Intronic
1074753700 10:116609617-116609639 CCCTCGTTGGCCCTGGCTCTTGG + Intergenic
1075415392 10:122258756-122258778 CCCATGTGGGTCCTGGGGCCAGG - Intergenic
1075727498 10:124618085-124618107 CCCACGTGGGGCCTGGCCCCAGG - Exonic
1075911051 10:126126156-126126178 CCCAGTTGGGACCTGGCTCCTGG + Intronic
1076135887 10:128045586-128045608 CCTCCGTGGGGCTGGGCTCCAGG + Intronic
1076793792 10:132789309-132789331 CCCGCCTGGGCCCGGGCTCCTGG - Intergenic
1076814829 10:132909573-132909595 CCCCACTAGGGCCTGGCTCCTGG + Intronic
1076885660 10:133261340-133261362 CACCCATGGGTGCTGCCTCCGGG - Intergenic
1076902810 10:133348066-133348088 TCCCCGTGGGTCCCCTCTCCAGG - Intronic
1076923031 10:133465422-133465444 CCGCCTTTGGCCCTGGCTCCGGG + Intergenic
1079307206 11:19333905-19333927 AGCCCGAGGGTCCTGGCTTCTGG - Intergenic
1082228975 11:49741522-49741544 CCTCCATGGTTCCTGGGTCCCGG + Intergenic
1083273425 11:61583525-61583547 CTCCCCAGGGTGCTGGCTCCGGG - Intergenic
1083607358 11:63986795-63986817 ACCCCTCGGCTCCTGGCTCCAGG + Intronic
1084062946 11:66687633-66687655 CCCCCCAGGGACCTGGCTCAGGG - Exonic
1084419111 11:69051526-69051548 CCCCTGTTGCTCCAGGCTCCAGG - Intronic
1084420784 11:69059479-69059501 TCCCAGTGGGTCCTGGCTGGGGG + Intronic
1084518073 11:69647064-69647086 CCCTCCTGGGGCCCGGCTCCCGG + Intronic
1087282626 11:96228702-96228724 CGCCTGAAGGTCCTGGCTCCTGG + Intronic
1088801905 11:113314499-113314521 CCGCCCCGGGCCCTGGCTCCTGG + Intergenic
1088896549 11:114083022-114083044 CCCGAGTGGCTCCTGGCCCCTGG + Intronic
1088984008 11:114889710-114889732 CCCACGTGAGTCCTGGCTGCGGG - Intergenic
1089378224 11:118010280-118010302 CCCTCCTGGCTCCTGGCACCTGG + Intergenic
1089757760 11:120698921-120698943 CCCCTGTGAGGCCTAGCTCCAGG + Intronic
1092074990 12:5665594-5665616 GGCTCCTGGGTCCTGGCTCCAGG - Intronic
1095949390 12:47773587-47773609 CCCACGCGGGCCCGGGCTCCTGG + Intronic
1097222183 12:57457407-57457429 TCCCAGTGGGTCCTGTCCCCTGG - Exonic
1102011191 12:109619567-109619589 CCCCCTGGGGTGCTGGTTCCTGG + Intergenic
1102013416 12:109632716-109632738 CCCCCTTGGGTCCAGGTTCCAGG - Intergenic
1102700644 12:114836133-114836155 CCTCCATGAGTCCTGCCTCCTGG - Intergenic
1104570873 12:129924642-129924664 CCCACGTGAGACCGGGCTCCTGG + Intergenic
1104570883 12:129924697-129924719 CCCACGTGAGACCGGGCTCCTGG + Intergenic
1104570892 12:129924752-129924774 CCCACGTGAGACCGGGCTCCTGG + Intergenic
1104633604 12:130424615-130424637 CCCTCGGGGCTCCTGGTTCCCGG - Intronic
1104834777 12:131781934-131781956 CTACCGTGGGTGCTGGCCCCTGG + Intronic
1105030830 12:132882355-132882377 TCCCCCTGAGTCCCGGCTCCTGG - Intronic
1106680702 13:32004112-32004134 CCACCTGGGGTCCAGGCTCCAGG + Intergenic
1109572123 13:64206727-64206749 CTGCCTTGGGTCCTGGCACCTGG + Intergenic
1110728441 13:78852945-78852967 CCCCCATGGACCCAGGCTCCAGG + Intergenic
1110808893 13:79790741-79790763 CCCTAGTGGATCCGGGCTCCAGG - Intergenic
1112065851 13:95792040-95792062 CCCACGTGGGACCTGTCTGCTGG + Exonic
1113448956 13:110392435-110392457 CCCTCGAGGGTCCCAGCTCCTGG - Intronic
1113721618 13:112562088-112562110 CCCTAGTGGGTCCTGGCTGGTGG - Intronic
1113721634 13:112562142-112562164 CCCTAGTGGGTCCTGGCTGGTGG - Intronic
1113721642 13:112562169-112562191 CCCTAGTGGGTCCTGGCTGGTGG - Intronic
1113721650 13:112562196-112562218 CCCTAGTGGGTCCTGGCTGGTGG - Intronic
1114620607 14:24094178-24094200 GCCCCGGGGCTCCAGGCTCCAGG - Exonic
1118323939 14:64769000-64769022 TGCCCCTGGGCCCTGGCTCCAGG + Intronic
1118772417 14:68951176-68951198 CCTCCCTGGGCCCTGACTCCAGG + Intronic
1118824582 14:69368669-69368691 CCCCAGTGATTCCTGCCTCCTGG - Intergenic
1120135728 14:80866185-80866207 CCCCCGTGGGCCCAGGTACCAGG + Intronic
1121215752 14:92246364-92246386 CCCCAGTGATTCCTGCCTCCTGG - Intergenic
1121307023 14:92912887-92912909 CCCCCTTGGCTCCCAGCTCCAGG - Intergenic
1122968389 14:105142654-105142676 CCACCGAGGGCCCTGGGTCCCGG + Exonic
1123587025 15:21769919-21769941 GGCTCCTGGGTCCTGGCTCCAGG + Intergenic
1123623663 15:22212484-22212506 GGCTCCTGGGTCCTGGCTCCAGG + Intergenic
1127267930 15:57376392-57376414 CCCCGGCGGGTCCAGGCCCCCGG + Intronic
1127288070 15:57547707-57547729 CCCCAGTGGGTGGTGGCTCCTGG - Exonic
1127366826 15:58299262-58299284 CCCTAGTGAGTTCTGGCTCCTGG + Intronic
1128685200 15:69679102-69679124 CCACCATGGCTCCTGCCTCCTGG - Intergenic
1128866006 15:71115625-71115647 CCCGCGTGGTTCCCGGCGCCGGG - Intronic
1130985196 15:88840216-88840238 CCCCTGTGGCTGCTGACTCCTGG - Intronic
1132092405 15:98957039-98957061 CTCCCGTGTGTCTTGGCTGCAGG + Exonic
1132147582 15:99437667-99437689 CCTCCCTGGGTCCTGGGTCCTGG - Intergenic
1132513430 16:354817-354839 CCCCGCTGGGTCCTGGCCGCAGG + Intergenic
1132547765 16:541102-541124 CCCCCGTGGGAGCTGCCGCCAGG - Intronic
1132567168 16:628859-628881 CCACGGGGGGTCCTGGGTCCCGG - Exonic
1132713988 16:1281656-1281678 CCCCCCTCAGCCCTGGCTCCCGG - Intergenic
1132892411 16:2210741-2210763 ACCCCCTGGGTCCTTGCTGCAGG + Intronic
1133335073 16:5001694-5001716 CCACCGTAAGTACTGGCTCCGGG - Intronic
1134668351 16:16036450-16036472 CCCCCTTGTGTCTTGGCCCCAGG + Exonic
1135916096 16:26606822-26606844 CCACCTGGTGTCCTGGCTCCTGG - Intergenic
1136008390 16:27346691-27346713 CCTCCCAGGCTCCTGGCTCCAGG - Intronic
1136612108 16:31372505-31372527 CCTCCGTGAGTCCTGGCACTGGG + Exonic
1136933485 16:34437786-34437808 CCTCCCGGCGTCCTGGCTCCGGG + Intergenic
1136971087 16:34974028-34974050 CCTCCCGGCGTCCTGGCTCCGGG - Intergenic
1137388840 16:48064834-48064856 CCCCCTGGAGGCCTGGCTCCTGG - Intergenic
1137624659 16:49900082-49900104 CCCCCGTGGGTGCGGGGCCCTGG - Intergenic
1139359857 16:66390827-66390849 CCGCAGTGGGTCATTGCTCCTGG - Intronic
1140478678 16:75251290-75251312 CCCCCGCGGTTCCTGCCTCCCGG + Intronic
1141153869 16:81583298-81583320 CCCCCCGGGGTCGGGGCTCCGGG + Intronic
1141699269 16:85635023-85635045 CCCCGGAGGGCCCTGGCACCCGG - Intronic
1141764816 16:86051492-86051514 CCCTGGTGTGACCTGGCTCCTGG - Intergenic
1141884621 16:86882972-86882994 CCTAAGTGGGACCTGGCTCCTGG + Intergenic
1142107690 16:88315162-88315184 CCCCCGAGGGCCAGGGCTCCAGG + Intergenic
1142187652 16:88702029-88702051 CACCCATGGGCCCTGGCTCTTGG + Intronic
1142189289 16:88710296-88710318 ACCCCGTGGGCCCGGGCTGCTGG + Intronic
1142211351 16:88810100-88810122 CCACCCTCTGTCCTGGCTCCAGG + Exonic
1142229129 16:88891443-88891465 CACCCCAGGGTGCTGGCTCCAGG + Intronic
1142393331 16:89816565-89816587 GCCCCCTGGGTCCTGGCCCGAGG + Exonic
1143117095 17:4587271-4587293 ACCCCTTGAGCCCTGGCTCCCGG + Intronic
1144438506 17:15261648-15261670 CTCCCTTCGGTCCAGGCTCCTGG - Intronic
1144520833 17:15951355-15951377 GGCCCATGGGCCCTGGCTCCTGG + Intronic
1145168806 17:20637196-20637218 TCCCCGGTGGTCCTGCCTCCTGG + Intergenic
1145267993 17:21389695-21389717 CCCACGTGGGGCCAGGATCCAGG - Intronic
1145970079 17:28951197-28951219 GCACAGTGGGTCCCGGCTCCGGG + Exonic
1146849856 17:36212518-36212540 CCCCAGTGAGTCCTGGGTCCAGG + Exonic
1147324293 17:39662992-39663014 CCCACATGGGACCTGGCCCCAGG + Exonic
1147552897 17:41457103-41457125 CCCCAGGGGGTCCAGGGTCCAGG + Intergenic
1147906319 17:43825469-43825491 CCCTCCTGGGTCCTGGGTCCTGG - Intronic
1148867296 17:50635154-50635176 ACCGCGTGGGACCCGGCTCCGGG - Intronic
1150291258 17:63983641-63983663 CATCCGAGGCTCCTGGCTCCAGG - Intergenic
1152286160 17:79414484-79414506 GCCCCGTGTGTCCAGGCCCCAGG + Intronic
1152520339 17:80852550-80852572 CCAGCGTGGGAGCTGGCTCCGGG + Intronic
1152552885 17:81038620-81038642 CCCAACTGGCTCCTGGCTCCAGG - Intronic
1152694223 17:81735577-81735599 CCCCTGTGGGACCAGGCACCCGG + Intergenic
1153051027 18:903540-903562 CCCCCGTTAGTCCTGGCTTTTGG - Intergenic
1155934649 18:31742189-31742211 CCTCCCTGGTTCCTGGGTCCCGG + Intergenic
1157842032 18:50967935-50967957 CCCGCGCGGGACCTGGCTCTGGG - Intergenic
1158391920 18:57051305-57051327 CCCCAGTGGGTCCTTGGTGCTGG + Intergenic
1160149118 18:76385862-76385884 GCCACGAGGGTCCTGGCACCGGG - Intronic
1160534041 18:79581660-79581682 CCCCGGTGGGTGCTGTCTCATGG - Intergenic
1160536961 18:79599837-79599859 CCCCAGTGGGTCCTGTCCCTCGG + Intergenic
1160544283 18:79642309-79642331 GCCCCGTGGGTTCTGGCGTCGGG - Intergenic
1160660322 19:295176-295198 AGGCCGTGGGTCGTGGCTCCGGG + Intergenic
1160793548 19:933679-933701 TCCCCGGGGCTCCTGACTCCAGG + Intronic
1161720005 19:5897411-5897433 CCCCCACGGGCCCTGGCACCAGG + Intronic
1162013449 19:7831108-7831130 CCCATCTGGATCCTGGCTCCTGG + Intronic
1162402462 19:10454316-10454338 ATCCTGGGGGTCCTGGCTCCTGG - Intronic
1162566151 19:11446679-11446701 TCCCCGTGGCCCCTGGCTTCTGG + Intronic
1163033337 19:14558435-14558457 GCACCGTGTGTCCTGGCTCTTGG + Intronic
1163763439 19:19149429-19149451 CCCCTGTGGGTCCTGGGTCCAGG - Exonic
1164643496 19:29842985-29843007 CCCACATGGGGCCTGGCTTCAGG + Intergenic
1164754742 19:30681252-30681274 CCCACAAGGGTCCTGACTCCTGG + Intronic
1165079648 19:33300081-33300103 CCCCCAGAGGCCCTGGCTCCTGG - Exonic
1165361211 19:35338074-35338096 CCCCCGTGGCTCCCCTCTCCGGG - Intronic
1165524217 19:36339364-36339386 CCCCCAGTGGTCCTGTCTCCAGG + Exonic
1166059548 19:40317482-40317504 CCCCTGTGGGTCATGGCTGTTGG + Intergenic
1166075911 19:40413657-40413679 CCCCACTGTTTCCTGGCTCCAGG + Intergenic
1166807546 19:45496502-45496524 CCCGCGCGCGTCCTCGCTCCCGG + Intronic
1167269182 19:48498401-48498423 CCTTCCTGGGTCCTGTCTCCCGG + Exonic
1168644967 19:58053879-58053901 CTCCCGGGGGCCCTTGCTCCGGG - Exonic
927215666 2:20666860-20666882 CCTCCGTGGTTCCAGGCTCGGGG - Exonic
927812722 2:26188872-26188894 CACCTGTGGGTCCTGGTTCATGG + Exonic
928455741 2:31420056-31420078 CCCCAGTGGATCCTGACCCCAGG - Intergenic
928710276 2:33997427-33997449 CCCAAGTGTATCCTGGCTCCAGG - Intergenic
930705986 2:54505607-54505629 TCCCCAGGGGTCCTAGCTCCTGG + Intronic
931429157 2:62195946-62195968 CCCGGGTGGGTCCTGGTACCGGG + Intergenic
932456449 2:71852623-71852645 GCCCCGCAGGTCCAGGCTCCGGG - Intergenic
932485548 2:72082237-72082259 GCCCCATGGGGCCTGGCTCCTGG + Intergenic
933953785 2:87351854-87351876 CCACCGTGGTTCCTGGTTCCTGG + Intergenic
934713009 2:96527739-96527761 CCCCTGTGGGCACTGGCTCCGGG - Intergenic
934993053 2:98935044-98935066 CGCCCGTGGGACCGAGCTCCAGG + Intronic
935209315 2:100924726-100924748 ACCCCGTGGGCCCTGGAACCAGG + Intronic
935608985 2:105001328-105001350 CTCCAGTGGGTCCTGGGTCCAGG + Intergenic
936126455 2:109792499-109792521 CCCTCCTGCGTCTTGGCTCCTGG - Intergenic
936218238 2:110578969-110578991 CCCTCCTGCGTCTTGGCTCCTGG + Intergenic
939151349 2:138476884-138476906 CTCCTGTGGATCCTGGCTCCTGG - Intergenic
939892595 2:147755294-147755316 CCCCCGTGCCTTCTGCCTCCTGG - Intergenic
940448654 2:153810238-153810260 CAGCCGTGGGCCATGGCTCCAGG + Intergenic
940962153 2:159797964-159797986 CCCCCGTGGGTCCTGGCTCCGGG - Intronic
942062568 2:172241208-172241230 ACCAAGTGGGTCCTGGCTTCTGG + Intergenic
946306658 2:218860167-218860189 CCCCAGTCTGTCCTGGGTCCCGG - Intronic
946332387 2:219017790-219017812 GCCCTGTAGGGCCTGGCTCCGGG + Intronic
946332510 2:219018377-219018399 CCCCCGAGGGTCCTGGCTGAGGG - Intronic
947248977 2:228079789-228079811 CCCCAGTGGATCCTGGCCTCTGG + Intronic
947876940 2:233473972-233473994 CCCCTTTGTGCCCTGGCTCCAGG + Intergenic
948604038 2:239123493-239123515 GCCCCTTGGGGCCTTGCTCCAGG - Intronic
948807980 2:240461138-240461160 CCACCTTGGGTCCTGGCGCCTGG - Intronic
1168806218 20:673797-673819 GCCCCGTTGGTCCTGTCCCCAGG - Intronic
1168835606 20:875346-875368 CCCCCATGGATCTGGGCTCCAGG + Intronic
1170626627 20:18034969-18034991 CGGCCCTGGGTCCTGGGTCCTGG + Intronic
1172777406 20:37415542-37415564 CCCCTGTGGGTGCTGGGTCAGGG - Intergenic
1173030020 20:39348080-39348102 CCCCAGTGGATCCAGGCTCCAGG + Intergenic
1173069002 20:39743405-39743427 CCCCCCTGCATTCTGGCTCCTGG + Intergenic
1173613186 20:44385813-44385835 CCACTGTTGGTCCTGGCACCTGG + Intronic
1173795536 20:45857102-45857124 CGCCCGGGGCCCCTGGCTCCGGG - Intronic
1174299947 20:49574360-49574382 GCCCTGTGGGTCATGGCTCAAGG - Intergenic
1174451867 20:50625641-50625663 TCCCAGTGGCTCCTGGCTCGGGG + Intronic
1174554758 20:51386174-51386196 CCTGCATGGGTCCTGGCTGCTGG - Intergenic
1175904343 20:62372233-62372255 CCCCTGGGGTTCCTGGCCCCTGG - Intergenic
1176089889 20:63314081-63314103 GTCACGTGGCTCCTGGCTCCTGG - Exonic
1176143164 20:63553952-63553974 CCCCCTTGGAGCCTGGCTCTTGG + Exonic
1178498880 21:33109776-33109798 CGCCCGCAGGTCCTCGCTCCCGG + Intergenic
1179905035 21:44418348-44418370 CCCCGGTGGGTCAGGGCTTCAGG + Intronic
1179925771 21:44533426-44533448 ACCCCATGGCTCCTGGCCCCTGG + Intronic
1179925793 21:44533488-44533510 ACCCCATGGCTCCTGGCCCCTGG + Intronic
1180059470 21:45377149-45377171 ACCCCGGGGGACCTGGCTGCTGG + Intergenic
1181029409 22:20142682-20142704 CCCCCGTGGGTGCTGACTGGCGG + Intronic
1184401448 22:44276936-44276958 CACCGCAGGGTCCTGGCTCCTGG - Intronic
1184414195 22:44342697-44342719 CCCTCATGGGGCCTGGATCCAGG - Intergenic
1184502173 22:44880729-44880751 CCCCCCTGAGTCCTAGCTCCTGG - Intergenic
1185140464 22:49098033-49098055 GACCCGTGAGTCCTGGCTACGGG - Intergenic
1185157584 22:49203498-49203520 CGCCAGTGGGTCCCGCCTCCTGG - Intergenic
950523516 3:13509983-13510005 CTCCCATGGCTCCAGGCTCCTGG + Intergenic
950642642 3:14358497-14358519 CCTCCCTGCCTCCTGGCTCCAGG + Intergenic
952629906 3:35453610-35453632 CCACTGTGGGTCCTGCCTCAGGG + Intergenic
953625966 3:44571452-44571474 CCACCGTGACTACTGGCTCCGGG - Exonic
954028671 3:47802991-47803013 CCCAGGTGGGGCCGGGCTCCAGG + Exonic
954156249 3:48686303-48686325 CCCCCGCGGGGCCCGGCTCTCGG + Intronic
954879347 3:53823221-53823243 GGCCCGTGGCTCCAGGCTCCTGG - Intronic
954930248 3:54275011-54275033 CCCCAGTGGTCCCTGCCTCCTGG - Intronic
958918270 3:100073781-100073803 CCTCTGTGGGTCTTGTCTCCAGG + Intronic
961435981 3:126916906-126916928 GGCAGGTGGGTCCTGGCTCCAGG - Intronic
961773567 3:129267915-129267937 CCACCTTGTGTCCTGGCTGCAGG + Exonic
965590399 3:170356899-170356921 CCCCCGCGGGACCTCCCTCCTGG - Intergenic
968137294 3:196228396-196228418 CGCCCGTGGGTCCTGGCCGTGGG - Intronic
968172244 3:196519903-196519925 CCTCCTTGGTTCCTGGGTCCTGG - Intergenic
968262085 3:197333589-197333611 CTCACGTGGTTCCTGGCTGCTGG - Intergenic
968690341 4:1986869-1986891 CCCCCGGGCGTCCTCTCTCCGGG - Intronic
969474065 4:7411285-7411307 CTCCCTTGGGTCCGGGCTCCAGG + Intronic
969718024 4:8877766-8877788 CCCCGGCGGTTCCAGGCTCCAGG - Intergenic
971732719 4:30406694-30406716 CCCCAGTGGGGCAGGGCTCCAGG - Intergenic
973287186 4:48431788-48431810 CTTCCCTGGCTCCTGGCTCCTGG + Intergenic
981074742 4:140579573-140579595 CCCCCTTGCGCCCTAGCTCCCGG + Intergenic
982128046 4:152201316-152201338 CATCCGTGGGTCCTAGCTCTAGG + Intergenic
983062262 4:163173503-163173525 CCTCCTTGGTTCCTGGGTCCTGG - Intergenic
984795723 4:183658850-183658872 CCCCCGTGAGACCTGGTGCCCGG - Intronic
985671047 5:1206836-1206858 CCGACATGGGTCCTGTCTCCTGG - Intronic
985714590 5:1448230-1448252 CCTCCTTGGGTGCTGCCTCCTGG + Intergenic
985727818 5:1524937-1524959 CCCCCCAGGGTCCTGGCTCCTGG + Intergenic
985836532 5:2276250-2276272 CCCCCGTGGGTGCTGCCACGTGG + Intergenic
985972341 5:3388354-3388376 GCACCGTGGGCCCTGGTTCCAGG - Intergenic
986331118 5:6716698-6716720 TGCCCCTAGGTCCTGGCTCCTGG + Intronic
986721268 5:10563315-10563337 TCCCCGTCAGTCCTGGCGCCGGG - Intergenic
986727674 5:10611593-10611615 GACCCTTGGGTCCTGCCTCCCGG + Intronic
988344277 5:30017969-30017991 CCCCTGTGGTTCCAAGCTCCAGG + Intergenic
988376298 5:30439794-30439816 CAACTGTGGGTCTTGGCTCCTGG + Intergenic
992017098 5:72586533-72586555 CCCCAGTGGTTCTTGCCTCCTGG + Intergenic
994787156 5:104179918-104179940 CCTCCGTGGTTCCTGGGTCCTGG - Intergenic
995185720 5:109267999-109268021 CCCCCATGGGCTCAGGCTCCAGG + Intergenic
996477346 5:123936749-123936771 TCCCCATGGTTCCTGGGTCCTGG + Intergenic
998446380 5:142201857-142201879 CATCTGTGGGTCTTGGCTCCAGG + Intergenic
999271116 5:150296884-150296906 CCACCGTGGCCCCAGGCTCCAGG + Exonic
1001454738 5:171852111-171852133 CGCCCGTGTTTCATGGCTCCTGG - Intergenic
1001482052 5:172095408-172095430 CCTCAGTGGGGCCTGGCTCCAGG - Intronic
1001877054 5:175210678-175210700 TCCTCCTGGGTCCTGGCACCTGG - Intergenic
1003112911 6:3264089-3264111 CCCCTGTGGGTGGTGGCTCAAGG + Intronic
1004342770 6:14822110-14822132 CCTCCGTGTGACCTGTCTCCAGG - Intergenic
1006397405 6:33796346-33796368 CACCCAAGGGGCCTGGCTCCAGG + Intronic
1006444390 6:34070652-34070674 CAGCCCTGGGTCCTGGGTCCTGG - Intronic
1006472958 6:34238256-34238278 CCCCCGCGCGCCCTGGCCCCGGG + Intronic
1006510975 6:34520862-34520884 CCCTCCTGGCTCCTGGCTCCTGG + Intronic
1006950946 6:37820248-37820270 CCCCCGTGGGCCCGAGCTTCAGG - Intronic
1007408620 6:41648912-41648934 GACCCGGGGGTCCTGGCTTCAGG + Intronic
1008465791 6:51829289-51829311 CCACTGTGTGTCCTGGGTCCCGG - Intronic
1009657697 6:66567833-66567855 CCTCCATGGTTCCTGGGTCCTGG + Intergenic
1011188759 6:84708226-84708248 CACCCAAGGATCCTGGCTCCAGG - Intronic
1011518619 6:88179958-88179980 CCCCCTTGCCTGCTGGCTCCGGG - Intergenic
1012821243 6:104087560-104087582 CCCCAGGGGATCCTGGCACCAGG - Intergenic
1013552019 6:111217157-111217179 CCCCCGTGGGCCATGGTTCCAGG + Intronic
1014013913 6:116507672-116507694 CCCCTGTGGGTCTTGGTTGCAGG + Intronic
1014198128 6:118581600-118581622 CCTCCCTGGTTCCTGGGTCCCGG - Intronic
1016934865 6:149441965-149441987 CCCGTGCGGGCCCTGGCTCCTGG - Intergenic
1018199148 6:161379228-161379250 CCCTGATGGGTCCAGGCTCCTGG - Intronic
1018581881 6:165315060-165315082 GCCACCTGGTTCCTGGCTCCTGG + Intergenic
1019016710 6:168885368-168885390 CCCCCATGGGGCCAGGCCCCGGG - Intergenic
1019135399 6:169904673-169904695 CCCCCGTGGCAACTGTCTCCAGG + Intergenic
1019218258 6:170457383-170457405 CACCAGTGTCTCCTGGCTCCAGG + Intergenic
1019349894 7:549772-549794 GCCCCGTGTGTCTTGGCGCCCGG + Exonic
1019540731 7:1549970-1549992 CCCCTGGGGGACCTGGCCCCAGG - Intronic
1020728051 7:11841815-11841837 CCCCAGTGGCTCCAGGCTCTGGG - Intergenic
1021033466 7:15768210-15768232 CCCTCATGGCTCCAGGCTCCAGG + Intergenic
1021190435 7:17613606-17613628 CCCCTGTGGATACAGGCTCCAGG - Intergenic
1024059083 7:45685131-45685153 CAGCCCTGGGTCCTGGCTTCTGG - Intronic
1025958252 7:66199128-66199150 TCTCCCTGGGTCCCGGCTCCTGG + Intergenic
1027245778 7:76366296-76366318 AACCTGTGGGTCCTGCCTCCTGG - Intergenic
1028351759 7:89858044-89858066 CCCTCTTGGTTCCTGGATCCTGG - Intergenic
1028981117 7:96969019-96969041 GCTCCTTGGATCCTGGCTCCTGG - Intergenic
1031036656 7:116794747-116794769 CCCCCCTGGGTCCTGTCCACAGG + Intronic
1031239574 7:119220002-119220024 CCCCAGTGCATCCAGGCTCCAGG - Intergenic
1031575348 7:123409529-123409551 CCCCTGTGTGATCTGGCTCCTGG + Intergenic
1033705909 7:143884996-143885018 CCCCCTTGGGTTTTGGGTCCAGG - Intronic
1037099997 8:15032883-15032905 CCCCTGTGGCCCCAGGCTCCAGG + Intronic
1040526132 8:48226698-48226720 CCTCCATGGTTCCTGGGTCCTGG - Intergenic
1043847400 8:85177928-85177950 CCCGCGTGGCTTCTGTCTCCGGG + Intronic
1043871506 8:85438623-85438645 CTCCCGGGAGTCGTGGCTCCTGG - Intronic
1044717377 8:95112957-95112979 CCCCCTTAGGTGCTGGATCCTGG + Intronic
1045286782 8:100798531-100798553 CACCAGTGGCTCCTGGCACCTGG - Intergenic
1047421341 8:124710531-124710553 CTGCCATGGGTCCTGGCTCTAGG - Intronic
1048687434 8:136919669-136919691 CCACTGTGGCTCATGGCTCCTGG + Intergenic
1049109736 8:140635467-140635489 CCCCGGTGAGTCCTGGCGCTCGG - Exonic
1049725030 8:144141884-144141906 CTCCCGTGGGCCCTGGCCACAGG + Intergenic
1049726452 8:144148509-144148531 CCACCGGGGGTCCTCTCTCCGGG + Intronic
1054761312 9:69006643-69006665 TCCCCTGGGGTCCTGGCTCCAGG + Intronic
1057646216 9:96877449-96877471 CCCGCGTGGCTCCAGCCTCCTGG + Intergenic
1059251507 9:112891034-112891056 GCCCCGGGGGTGCTGGCGCCAGG - Intergenic
1060520276 9:124290383-124290405 CCCCCAAGGGTGCTGGCACCTGG + Intronic
1060812183 9:126615987-126616009 ACCTCCTGGCTCCTGGCTCCAGG - Intronic
1061429028 9:130519458-130519480 GGCCCGTGGCTCCTGGCTCCAGG - Intergenic
1062129086 9:134883109-134883131 GCCCCGTGAGGCCTGGGTCCTGG + Intronic
1062186649 9:135221963-135221985 ACTCCCTGGGTTCTGGCTCCAGG - Intergenic
1062416543 9:136454104-136454126 CCCACCTGGGTCTGGGCTCCTGG + Exonic
1062494132 9:136823676-136823698 CCCCAGTGGGTTCGGGCTCCAGG + Intronic
1062517159 9:136942497-136942519 CCCTCCTGGGGCCTGGCGCCCGG - Intronic
1062621867 9:137426446-137426468 CCTCCATGGTTCCTGGCTCCAGG + Intronic
1185567970 X:1110094-1110116 CCCCCCTCGGTCCTGCCTCCTGG - Intergenic
1185756380 X:2656216-2656238 CCTCCCTGGGTTCTGACTCCAGG - Intergenic
1186674287 X:11799668-11799690 CCCCAGTGCTCCCTGGCTCCTGG + Intergenic
1187568192 X:20473978-20474000 CCCCAGTGAATCCTGCCTCCTGG - Intergenic
1189268709 X:39735669-39735691 CCCCTGTGAGGCCTGGGTCCTGG + Intergenic
1190228669 X:48564598-48564620 CCCCCATGATTCCTGCCTCCTGG - Intergenic
1190268940 X:48847501-48847523 CCCTCCTGGGTCGTGGATCCTGG + Intergenic
1190538929 X:51457601-51457623 CCTCCATGGTTCCTGGGTCCTGG - Intergenic
1193065267 X:77253026-77253048 CCCCAATGGGTCCTGGATCCAGG + Intergenic
1194105366 X:89761179-89761201 CCTCCCTGGTTCCTGGGTCCCGG + Intergenic
1196320522 X:114334748-114334770 CCCCTGTGGTGCCAGGCTCCAGG - Intergenic
1199845221 X:151688054-151688076 CCCCTGTGGGCCATAGCTCCTGG + Intergenic
1200002958 X:153071705-153071727 CCCTCCTAGGTGCTGGCTCCTGG + Intergenic
1200004765 X:153078304-153078326 CCCTCCTAGGTGCTGGCTCCTGG - Intergenic
1200457332 Y:3408996-3409018 CCTCCCTGGTTCCTGGGTCCCGG + Intergenic