ID: 940962155

View in Genome Browser
Species Human (GRCh38)
Location 2:159797965-159797987
Sequence TCCCCCGTGGGTCCTGGCTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 193}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940962155_940962167 3 Left 940962155 2:159797965-159797987 CCGGAGCCAGGACCCACGGGGGA 0: 1
1: 0
2: 1
3: 14
4: 193
Right 940962167 2:159797991-159798013 GCGTGCAGGGAAGGGCGGGATGG 0: 1
1: 0
2: 3
3: 44
4: 556
940962155_940962172 26 Left 940962155 2:159797965-159797987 CCGGAGCCAGGACCCACGGGGGA 0: 1
1: 0
2: 1
3: 14
4: 193
Right 940962172 2:159798014-159798036 CCGGCCGGGTGTTGCGTCTGCGG 0: 1
1: 0
2: 0
3: 2
4: 56
940962155_940962170 12 Left 940962155 2:159797965-159797987 CCGGAGCCAGGACCCACGGGGGA 0: 1
1: 0
2: 1
3: 14
4: 193
Right 940962170 2:159798000-159798022 GAAGGGCGGGATGGCCGGCCGGG 0: 1
1: 0
2: 1
3: 11
4: 294
940962155_940962168 7 Left 940962155 2:159797965-159797987 CCGGAGCCAGGACCCACGGGGGA 0: 1
1: 0
2: 1
3: 14
4: 193
Right 940962168 2:159797995-159798017 GCAGGGAAGGGCGGGATGGCCGG 0: 1
1: 0
2: 1
3: 67
4: 1050
940962155_940962163 -6 Left 940962155 2:159797965-159797987 CCGGAGCCAGGACCCACGGGGGA 0: 1
1: 0
2: 1
3: 14
4: 193
Right 940962163 2:159797982-159798004 GGGGGACGGGCGTGCAGGGAAGG 0: 1
1: 0
2: 3
3: 84
4: 710
940962155_940962173 27 Left 940962155 2:159797965-159797987 CCGGAGCCAGGACCCACGGGGGA 0: 1
1: 0
2: 1
3: 14
4: 193
Right 940962173 2:159798015-159798037 CGGCCGGGTGTTGCGTCTGCGGG 0: 1
1: 0
2: 0
3: 3
4: 45
940962155_940962164 -5 Left 940962155 2:159797965-159797987 CCGGAGCCAGGACCCACGGGGGA 0: 1
1: 0
2: 1
3: 14
4: 193
Right 940962164 2:159797983-159798005 GGGGACGGGCGTGCAGGGAAGGG 0: 1
1: 0
2: 4
3: 63
4: 1159
940962155_940962165 -2 Left 940962155 2:159797965-159797987 CCGGAGCCAGGACCCACGGGGGA 0: 1
1: 0
2: 1
3: 14
4: 193
Right 940962165 2:159797986-159798008 GACGGGCGTGCAGGGAAGGGCGG 0: 1
1: 0
2: 0
3: 23
4: 375
940962155_940962162 -10 Left 940962155 2:159797965-159797987 CCGGAGCCAGGACCCACGGGGGA 0: 1
1: 0
2: 1
3: 14
4: 193
Right 940962162 2:159797978-159798000 CCACGGGGGACGGGCGTGCAGGG 0: 1
1: 0
2: 0
3: 8
4: 107
940962155_940962166 -1 Left 940962155 2:159797965-159797987 CCGGAGCCAGGACCCACGGGGGA 0: 1
1: 0
2: 1
3: 14
4: 193
Right 940962166 2:159797987-159798009 ACGGGCGTGCAGGGAAGGGCGGG 0: 1
1: 0
2: 0
3: 21
4: 372
940962155_940962169 11 Left 940962155 2:159797965-159797987 CCGGAGCCAGGACCCACGGGGGA 0: 1
1: 0
2: 1
3: 14
4: 193
Right 940962169 2:159797999-159798021 GGAAGGGCGGGATGGCCGGCCGG 0: 1
1: 0
2: 0
3: 28
4: 537

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940962155 Original CRISPR TCCCCCGTGGGTCCTGGCTC CGG (reversed) Intronic
900165068 1:1241268-1241290 TGCCCCCTGGGGCCTGGATCTGG - Intergenic
900298636 1:1965567-1965589 CTCTGCGTGGGTCCTGGCTCTGG + Intronic
900707311 1:4088864-4088886 TCCTCCCTGGGTCCTGGGGCAGG + Intergenic
901624438 1:10616051-10616073 TCCCCGGTGTGTCCTAGCCCTGG - Intronic
901646336 1:10718696-10718718 TCCCCAGTGGGTCAGGACTCCGG - Intronic
902032088 1:13430524-13430546 TCCCCAGAGGGAGCTGGCTCTGG - Intergenic
902577333 1:17386604-17386626 TGCCCCATGAGGCCTGGCTCAGG + Intronic
903493013 1:23743676-23743698 AGCCCCGCGGGGCCTGGCTCAGG - Intronic
904078395 1:27856826-27856848 TCCCCAGGGGATCCTGGCCCAGG + Intergenic
904420219 1:30386325-30386347 TGCCACGTGGGTCCTGGCTCTGG + Intergenic
905067100 1:35192895-35192917 GGCCCCATGGGTCCTGGCCCGGG - Exonic
905263022 1:36732451-36732473 TCCCCCAGTGGTCCTAGCTCTGG + Intergenic
907303951 1:53503605-53503627 GCCCCCGGGGGTCCTGCCTGGGG + Intergenic
907313237 1:53551813-53551835 TACCCGGTGGTTCCTGCCTCTGG + Intronic
917928548 1:179808172-179808194 TGGCCCGTGGGCCCTGACTCAGG + Intronic
917967497 1:180187741-180187763 TACCCCGAGGGCCCTGGCTCTGG - Intronic
923790297 1:237105969-237105991 TCCCACGTTGGTGCTGGCACTGG - Intronic
924872593 1:248064908-248064930 ACCCCTGTAGGTTCTGGCTCAGG + Intronic
1063022965 10:2147622-2147644 GCACCCGTAGCTCCTGGCTCAGG - Intergenic
1072547853 10:96454310-96454332 TCCTGCCTGGGTCCTGGCACTGG + Intronic
1072709536 10:97707162-97707184 TACCCAGTCTGTCCTGGCTCAGG + Intergenic
1075092237 10:119450343-119450365 TCTCCCTTGGGGCCTGGCACGGG - Intronic
1075637808 10:124042243-124042265 CCTCCCTGGGGTCCTGGCTCTGG - Intronic
1076053744 10:127354768-127354790 TCCCTGGTGGGTCATGGCACTGG + Intronic
1076712439 10:132345766-132345788 TGCTCCCTGTGTCCTGGCTCCGG - Intronic
1076795201 10:132794892-132794914 TTCCCCGGGTGTCCAGGCTCGGG + Intergenic
1076838201 10:133031876-133031898 CCCCACGAGGCTCCTGGCTCCGG + Intergenic
1076870203 10:133189260-133189282 TGCCCCGTGGGCCCTGACTCGGG + Intronic
1077172723 11:1175166-1175188 TCCCTCGTGTCTCCTGGCCCAGG + Intronic
1077347622 11:2071285-2071307 TCCACCCAAGGTCCTGGCTCAGG + Intergenic
1077412893 11:2411608-2411630 GCCCCCGGGGGCCCTGGCCCTGG - Intronic
1077436647 11:2542612-2542634 TCCTCCGCTGCTCCTGGCTCCGG + Intronic
1079756793 11:24274415-24274437 CACCCCGTGGGGCCGGGCTCGGG - Intergenic
1080503061 11:32888341-32888363 TCCCCCGGGGGGCAGGGCTCGGG - Intergenic
1083934239 11:65862097-65862119 TTCCCCGAGGGGCCTGGCCCAGG + Intronic
1084062948 11:66687634-66687656 CCCCCCCAGGGACCTGGCTCAGG - Exonic
1084272545 11:68036917-68036939 TCTCCCGGGTGTCCTGGCTGGGG + Intergenic
1084420783 11:69059478-69059500 GTCCCAGTGGGTCCTGGCTGGGG + Intronic
1084492787 11:69487582-69487604 TTCCCCGTCGGTCATGGCGCTGG + Intergenic
1088984010 11:114889711-114889733 ACCCACGTGAGTCCTGGCTGCGG - Intergenic
1089320413 11:117622664-117622686 TCCCCAGTGGATCAGGGCTCTGG - Intronic
1096109780 12:49021674-49021696 CCAACCCTGGGTCCTGGCTCTGG + Exonic
1102002499 12:109566137-109566159 TCCCCAGTGGTGCATGGCTCTGG - Intronic
1103977729 12:124714569-124714591 CCCCCCGTGGGTCCAGGCTGAGG + Intergenic
1104382868 12:128323268-128323290 TCCCCCATCAGTCCAGGCTCAGG - Intronic
1106541135 13:30691038-30691060 TCCCCCGCAGGTCCTGTCCCTGG + Intergenic
1107631035 13:42343276-42343298 TCACCCCTGGGTCCTCTCTCTGG + Intergenic
1108716786 13:53087891-53087913 TCACCCCTGTGTACTGGCTCTGG + Intergenic
1111241164 13:85476612-85476634 TCTCCCCAGGGTCCTGGCTGTGG + Intergenic
1113835347 13:113325342-113325364 TCCCCACTGGGTCCTGGACCTGG - Exonic
1121644394 14:95507889-95507911 TCCGGGGTGGGCCCTGGCTCTGG + Intergenic
1122155864 14:99750097-99750119 TCCCGCCTGGCTCCAGGCTCAGG - Intronic
1123923283 15:25085745-25085767 TTGTCCTTGGGTCCTGGCTCTGG + Intergenic
1124110585 15:26781800-26781822 TTCCCCGTGGGGCAGGGCTCAGG - Intronic
1124576075 15:30909638-30909660 AGCCCCATGGGGCCTGGCTCTGG + Intronic
1126896129 15:53258662-53258684 TGCCCCCTTGGTCCTGGCCCTGG + Intergenic
1127382096 15:58438895-58438917 TCCCCAGTGGGGCTTGGCTAGGG + Intronic
1129603129 15:77011912-77011934 GCCCCCATGAGTCCTGGCTTGGG + Intronic
1131399692 15:92114428-92114450 TCCCACGTGGCTTCTGGCTTGGG + Intronic
1131428374 15:92366006-92366028 ACCCCTGTGGTTCCTGCCTCAGG - Intergenic
1132012504 15:98288313-98288335 TCCCTCCCGGGACCTGGCTCAGG + Intergenic
1132546646 16:536242-536264 TCGGCCGTGGGTGCTGGCTCCGG - Intronic
1132552671 16:559925-559947 GCCCCCAGGGGCCCTGGCTCGGG + Intergenic
1132556331 16:574337-574359 TCCCCCATGAGCCCTGGCTGCGG + Exonic
1132564829 16:617104-617126 TTCCGCGTGGGTCTTGGCCCTGG + Intronic
1132738988 16:1401571-1401593 GCCACCGGGGGTCCTCGCTCAGG + Exonic
1132803796 16:1766566-1766588 TCCCCGCTGGGCTCTGGCTCTGG - Exonic
1136612106 16:31372504-31372526 GCCTCCGTGAGTCCTGGCACTGG + Exonic
1136933483 16:34437785-34437807 TCCTCCCGGCGTCCTGGCTCCGG + Intergenic
1136971089 16:34974029-34974051 TCCTCCCGGCGTCCTGGCTCCGG - Intergenic
1137565945 16:49532535-49532557 TCCCCCGTGGGGCCCGGTTCAGG - Intronic
1137765049 16:50971601-50971623 TCACCCATGGGGCCTGGCACAGG - Intergenic
1139659335 16:68410193-68410215 TGCCCCGTGGGTGCTGGGGCTGG + Intronic
1141153867 16:81583297-81583319 TCCCCCCGGGGTCGGGGCTCCGG + Intronic
1141649324 16:85384803-85384825 TCCCTCCTGGATCCTGGCGCTGG - Intergenic
1145970078 17:28951196-28951218 TGCACAGTGGGTCCCGGCTCCGG + Exonic
1146484891 17:33234941-33234963 TCCCCTGTGGGATCTGGCTGAGG + Intronic
1149517747 17:57293205-57293227 TCCCCTGTGGCCCCAGGCTCTGG - Intronic
1151724399 17:75876035-75876057 TCCCTCGGGGGTCCAGGCCCAGG + Exonic
1151974462 17:77476468-77476490 TTCCCAGAGGGTGCTGGCTCAGG + Intronic
1152011532 17:77721861-77721883 TTCCCTGGGAGTCCTGGCTCAGG + Intergenic
1152094225 17:78263730-78263752 TCCCACAAGGGCCCTGGCTCTGG - Intergenic
1152382880 17:79951362-79951384 TCCCTCCTGGGTCCTGTGTCTGG - Intronic
1152617781 17:81345854-81345876 CCCGCGGCGGGTCCTGGCTCGGG + Intergenic
1154371289 18:13765422-13765444 TCCCCAGTGGCTCCTGGGTAAGG + Intergenic
1157568709 18:48698018-48698040 TGCCACATGGTTCCTGGCTCTGG - Intronic
1157842034 18:50967936-50967958 GCCCGCGCGGGACCTGGCTCTGG - Intergenic
1160880101 19:1315813-1315835 CCCCCCGCGGCTCCGGGCTCAGG + Intergenic
1161155967 19:2732085-2732107 TGGCCCGGGGGTCCTGGCCCAGG + Intronic
1161216772 19:3098622-3098644 TGCCCCGTGGGGGCTGGCGCAGG - Intronic
1161350059 19:3786352-3786374 GCCCCCGCGGGTCCTAGCGCCGG + Intronic
1161579725 19:5074230-5074252 TCCCCTGTGGCCTCTGGCTCAGG + Intronic
1161583975 19:5095209-5095231 TCCGCCCTGGTTCCTGGATCAGG + Intronic
1163270700 19:16251733-16251755 TCCCAGGAAGGTCCTGGCTCTGG + Intergenic
1163316067 19:16541635-16541657 TCCCCCCTGGGCTCTGGATCAGG - Intronic
1164700042 19:30278615-30278637 TGCCCCCTGGGTCCTGGGCCAGG + Intronic
1165153452 19:33773892-33773914 TGCCCCGTGCCCCCTGGCTCCGG - Intergenic
1165838747 19:38774372-38774394 TCTCCTGTGGGTTCTGTCTCTGG + Intergenic
1165840818 19:38788403-38788425 TCTCCTGTGGGTTCTGTCTCTGG - Intergenic
1166081040 19:40444272-40444294 TCACTGGTGGGTCCTGGCACTGG - Exonic
1167287030 19:48603973-48603995 TCTCCCCTGGGACCTGGCTGAGG - Intronic
1167348712 19:48962380-48962402 TCTCCCGTGGGCCCTCGCCCTGG - Intergenic
1167498086 19:49830828-49830850 TCCACTGTGGCCCCTGGCTCCGG + Exonic
1168520850 19:57049534-57049556 TCTCCCATGTTTCCTGGCTCTGG + Intergenic
927215668 2:20666861-20666883 CCCTCCGTGGTTCCAGGCTCGGG - Exonic
928262286 2:29778811-29778833 CCCCCCGTGCGTCCTGCCACGGG + Intronic
930697942 2:54430842-54430864 TTCCCACTGGGTCCTGCCTCTGG - Intergenic
931530479 2:63208964-63208986 TCCCCATTTGGCCCTGGCTCTGG + Intronic
931849458 2:66237757-66237779 CCCCCCTTGGCTCCAGGCTCTGG + Intergenic
934713011 2:96527740-96527762 GCCCCTGTGGGCACTGGCTCCGG - Intergenic
936072441 2:109380363-109380385 TCCCTTCTGGGTCCTGGCACAGG + Intronic
936392526 2:112088022-112088044 GCCCCCGGGGGCCCAGGCTCAGG + Intronic
936853736 2:116932620-116932642 TCCCCTGTGGCCTCTGGCTCAGG - Intergenic
937067562 2:119029423-119029445 TTCCCCATGGGTCCTAGCCCAGG + Intergenic
938473842 2:131589975-131589997 TTCCCCTTGCTTCCTGGCTCAGG + Intergenic
939018525 2:136930775-136930797 TGCCCCTTTAGTCCTGGCTCAGG - Intronic
940962155 2:159797965-159797987 TCCCCCGTGGGTCCTGGCTCCGG - Intronic
941878587 2:170459765-170459787 TTCCCCGTGGGGCAGGGCTCAGG - Intronic
943624107 2:190180348-190180370 TCCCCCGCGGGGCCTGCCTTGGG - Intronic
946239446 2:218344889-218344911 TCCCCAGTGGGGCCCGGCCCCGG - Exonic
946332512 2:219018378-219018400 GCCCCCGAGGGTCCTGGCTGAGG - Intronic
946792819 2:223318795-223318817 TCCCTCATAGGTCCTGGGTCAGG - Intergenic
947900563 2:233718053-233718075 CCCACCGTGGGTCCTTGCTAGGG + Intronic
1169856465 20:10109027-10109049 TCCCCCGTGGGATCAGGCTGAGG + Intergenic
1171439233 20:25147682-25147704 TCCTCCGTGGTCCCTGGATCTGG - Intergenic
1172777408 20:37415543-37415565 CCCCCTGTGGGTGCTGGGTCAGG - Intergenic
1174451866 20:50625640-50625662 GTCCCAGTGGCTCCTGGCTCGGG + Intronic
1175727481 20:61329441-61329463 TCCCCCGTGGGTCTGGGATGTGG + Intronic
1179939740 21:44629632-44629654 TCCCCAGTGGGGCCTGGCTGGGG + Intronic
1180050619 21:45329465-45329487 TCCACCGTGGGCCTGGGCTCAGG + Intergenic
1182972913 22:34594327-34594349 TCTCCCTTGGGCCCTGGCTAGGG + Intergenic
1183409125 22:37644754-37644776 GCCCCAGTGGCCCCTGGCTCTGG - Intronic
1183654061 22:39175030-39175052 TCCCCCGGGGGGCCAGGGTCAGG - Intergenic
1184831857 22:46993878-46993900 GCCCTCCTGGCTCCTGGCTCGGG - Intronic
1184976475 22:48065978-48066000 TGCCCGGTGGCTCCTGGCTGTGG + Intergenic
950665081 3:14490422-14490444 TCCCCAGTGGGGCCTGGCCCTGG + Exonic
952629904 3:35453609-35453631 TCCACTGTGGGTCCTGCCTCAGG + Intergenic
953625968 3:44571453-44571475 TCCACCGTGACTACTGGCTCCGG - Exonic
954378188 3:50205704-50205726 TGCCCCATGGGCCCTGCCTCAGG - Intronic
954699051 3:52442157-52442179 TCCCTTGTGGGGCCTGGCCCAGG + Intronic
954785678 3:53090567-53090589 TAGCCCCTGGGTACTGGCTCTGG + Exonic
958989917 3:100831095-100831117 TCCCCAGTGGTTTCTGCCTCTGG + Intronic
960254039 3:115491253-115491275 TTACCTGTGGCTCCTGGCTCTGG - Intergenic
963639649 3:147843035-147843057 TCCCCCTAGGGGCCTGGCACAGG + Intergenic
968137295 3:196228397-196228419 GCGCCCGTGGGTCCTGGCCGTGG - Intronic
968510237 4:992341-992363 TGCCCTGTGGGTCCTGGGGCTGG + Intronic
968573666 4:1355124-1355146 TCCACCGTGGGTCCCGACGCGGG - Exonic
968690343 4:1986870-1986892 TCCCCCGGGCGTCCTCTCTCCGG - Intronic
969310679 4:6351530-6351552 TCCCCCATGGGTCCTGACCCAGG - Intronic
969610818 4:8226996-8227018 TCTCCTGTGGCTCCAGGCTCAGG - Exonic
973163688 4:47050958-47050980 CCCACCCTGGGTTCTGGCTCGGG + Intronic
978941697 4:114444076-114444098 TCTTCAGTGGGTCCTGGTTCCGG + Intergenic
984330484 4:178309255-178309277 ACCCCCTTGGGTCCTGGCTGAGG - Intergenic
984772087 4:183444821-183444843 CCACCCGCGGGTTCTGGCTCAGG - Exonic
987374219 5:17218576-17218598 TCCGCCCTGGGTCCCGGCCCCGG + Intronic
990495035 5:56338649-56338671 TAGCCAGTGGGCCCTGGCTCAGG + Intergenic
992042404 5:72848621-72848643 TCCTCCCTGGGTCCGGGCGCGGG + Intronic
997330061 5:133053428-133053450 ACCTCCCTGGCTCCTGGCTCAGG + Intronic
1002299128 5:178247683-178247705 TCTCTCCTGGGTCATGGCTCTGG + Intronic
1003092792 6:3118485-3118507 TCCCCTCTCGGTGCTGGCTCTGG - Intronic
1003578284 6:7316916-7316938 TCCGCCGTGGGGCAAGGCTCGGG - Intronic
1004045341 6:12018050-12018072 TTCCCCGTGGGGCAGGGCTCAGG - Intronic
1007075931 6:39066082-39066104 TCCCCGGTGAGTCCTGACTTGGG + Intronic
1009431751 6:63572977-63572999 GCCCCCGTCGCTCCGGGCTCGGG - Intronic
1015275992 6:131383945-131383967 TCCCCTGTGGGGCCTGGCTGTGG - Intergenic
1017691670 6:156971984-156972006 TCCCCCAGGATTCCTGGCTCTGG - Intronic
1018452243 6:163919802-163919824 TGCCCCGTGGGCACTGGCTGAGG + Intergenic
1018479424 6:164174905-164174927 TTCCCCGTTGCTCCTGGCTTAGG - Intergenic
1019057766 6:169235508-169235530 TCCCCAGGGAGGCCTGGCTCGGG - Intronic
1019144633 6:169968905-169968927 TCCCCCGTGGGCACTGTCCCTGG + Intergenic
1019161324 6:170068588-170068610 TCCTCCATGGTTCCTGGCTGTGG - Intergenic
1020728053 7:11841816-11841838 TCCCCAGTGGCTCCAGGCTCTGG - Intergenic
1031902893 7:127429402-127429424 CTCCCCGTGGGGCCGGGCTCGGG + Intronic
1034339335 7:150341733-150341755 TCCCCAGTGGGACCGGCCTCTGG + Intergenic
1035650494 8:1260570-1260592 TCACCCCGGAGTCCTGGCTCAGG + Intergenic
1035650517 8:1260701-1260723 TCTCCCCGGAGTCCTGGCTCAGG + Intergenic
1039456408 8:37710407-37710429 TCCCGCCTTGGGCCTGGCTCTGG - Intergenic
1041166999 8:55101421-55101443 TCCACCGAGGGCGCTGGCTCGGG + Intergenic
1044728023 8:95208615-95208637 TCAACCTTGGGTCCTGGCTAAGG - Intergenic
1045878843 8:107014659-107014681 ACCCCAGTGGCTCCAGGCTCTGG + Intergenic
1046751830 8:117934503-117934525 TCCCCAGTGGGAACTGCCTCTGG - Intronic
1048313945 8:133348498-133348520 TCCCCCTTGGGGCCAAGCTCTGG - Intergenic
1048569569 8:135640398-135640420 TCCCACTTGAGTCCTTGCTCAGG + Intronic
1049436870 8:142590468-142590490 TCGCCCATGGTTCCTGGTTCTGG + Intergenic
1049620061 8:143594125-143594147 TTCCCCCTGGGGCCTGGCTCTGG - Intronic
1056636791 9:88337912-88337934 TTCCCCTTGGGTGCTGTCTCTGG - Intergenic
1061366741 9:130175926-130175948 TTCCCCGTGTGTCCCGGCTGTGG + Intronic
1062289590 9:135788600-135788622 TCCTCCCGGGGCCCTGGCTCGGG - Intronic
1062473751 9:136717801-136717823 TGCCTCGTGGGCCCTGGGTCTGG - Intronic
1062601974 9:137322435-137322457 TCCCTCGTGGGTCCGGGGTGAGG - Intronic
1062602075 9:137322790-137322812 TCCCTCGTGGGTCCGGGGTGGGG - Intronic
1062602087 9:137322826-137322848 TCCCTCGTGGGTCCGGGGTGGGG - Intronic
1062602099 9:137322862-137322884 TCCCTCGTGGGTCCGGGGTGGGG - Intronic
1062602111 9:137322898-137322920 TCCCTCGTGGGTCCGGGGTGGGG - Intronic
1062602123 9:137322934-137322956 TCCCTCGTGGGTCCGGGGTGGGG - Intronic
1062602187 9:137323114-137323136 TCCCTCGTGGGTCCGGGGTGGGG - Intronic
1062602238 9:137323258-137323280 TCCCTCGTGGGTCCGGGGTGGGG - Intronic
1062602263 9:137323330-137323352 TCCCTCGTGGGTCCGGGGTGGGG - Intronic
1062602275 9:137323366-137323388 TCCCTCGTGGGTCCGGGGTGGGG - Intronic
1062602287 9:137323402-137323424 TCCCTCGTGGGTCCGGGGTGGGG - Intronic
1062602299 9:137323438-137323460 TCCCTCGTGGGTCCGGGGTGGGG - Intronic
1062602311 9:137323474-137323496 TCCCTCGTGGGTCCGGGGTGGGG - Intronic
1062602323 9:137323510-137323532 TCCCTCGTGGGTCCGGGGTGAGG - Intronic
1062602333 9:137323546-137323568 TCCCTCGTGGGTCCGGGGTGAGG - Intronic
1185774862 X:2794130-2794152 TTCCCCGTTGCTCCTGCCTCTGG - Intronic
1190928757 X:54931047-54931069 ATCCCTGTGGGTCCTGGCTATGG - Intronic
1194523169 X:94943085-94943107 TCCCCTATGGGTGCTGGCCCAGG - Intergenic
1200129570 X:153833646-153833668 TCCTCAGTGGGTCCAAGCTCTGG - Intergenic
1200904917 Y:8472158-8472180 TCCTCCTTTGGTCATGGCTCTGG - Intergenic