ID: 940962158

View in Genome Browser
Species Human (GRCh38)
Location 2:159797971-159797993
Sequence CGCCCGTCCCCCGTGGGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 100}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940962158_940962172 20 Left 940962158 2:159797971-159797993 CCAGGACCCACGGGGGACGGGCG 0: 1
1: 0
2: 0
3: 8
4: 100
Right 940962172 2:159798014-159798036 CCGGCCGGGTGTTGCGTCTGCGG 0: 1
1: 0
2: 0
3: 2
4: 56
940962158_940962173 21 Left 940962158 2:159797971-159797993 CCAGGACCCACGGGGGACGGGCG 0: 1
1: 0
2: 0
3: 8
4: 100
Right 940962173 2:159798015-159798037 CGGCCGGGTGTTGCGTCTGCGGG 0: 1
1: 0
2: 0
3: 3
4: 45
940962158_940962169 5 Left 940962158 2:159797971-159797993 CCAGGACCCACGGGGGACGGGCG 0: 1
1: 0
2: 0
3: 8
4: 100
Right 940962169 2:159797999-159798021 GGAAGGGCGGGATGGCCGGCCGG 0: 1
1: 0
2: 0
3: 28
4: 537
940962158_940962166 -7 Left 940962158 2:159797971-159797993 CCAGGACCCACGGGGGACGGGCG 0: 1
1: 0
2: 0
3: 8
4: 100
Right 940962166 2:159797987-159798009 ACGGGCGTGCAGGGAAGGGCGGG 0: 1
1: 0
2: 0
3: 21
4: 372
940962158_940962168 1 Left 940962158 2:159797971-159797993 CCAGGACCCACGGGGGACGGGCG 0: 1
1: 0
2: 0
3: 8
4: 100
Right 940962168 2:159797995-159798017 GCAGGGAAGGGCGGGATGGCCGG 0: 1
1: 0
2: 1
3: 67
4: 1050
940962158_940962167 -3 Left 940962158 2:159797971-159797993 CCAGGACCCACGGGGGACGGGCG 0: 1
1: 0
2: 0
3: 8
4: 100
Right 940962167 2:159797991-159798013 GCGTGCAGGGAAGGGCGGGATGG 0: 1
1: 0
2: 3
3: 44
4: 556
940962158_940962165 -8 Left 940962158 2:159797971-159797993 CCAGGACCCACGGGGGACGGGCG 0: 1
1: 0
2: 0
3: 8
4: 100
Right 940962165 2:159797986-159798008 GACGGGCGTGCAGGGAAGGGCGG 0: 1
1: 0
2: 0
3: 23
4: 375
940962158_940962170 6 Left 940962158 2:159797971-159797993 CCAGGACCCACGGGGGACGGGCG 0: 1
1: 0
2: 0
3: 8
4: 100
Right 940962170 2:159798000-159798022 GAAGGGCGGGATGGCCGGCCGGG 0: 1
1: 0
2: 1
3: 11
4: 294

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940962158 Original CRISPR CGCCCGTCCCCCGTGGGTCC TGG (reversed) Intronic
900109050 1:998008-998030 CGCTCGCCTCCCGTGGGCCCTGG + Intergenic
900638534 1:3677132-3677154 CACCTGTGCTCCGTGGGTCCCGG + Intronic
902214302 1:14924619-14924641 CGCCCGGCCCCGGCGGCTCCTGG - Intronic
905168912 1:36098698-36098720 CCCCTGTCCCCCTTGGGGCCTGG + Exonic
905816487 1:40954872-40954894 CGCCCCACCCCCGTGGGATCAGG - Intergenic
911057664 1:93722106-93722128 CGCCCCTCCCCCATGGGACCTGG - Intronic
914753012 1:150548864-150548886 CCCCCGATCCGCGTGGGTCCAGG - Intergenic
920912874 1:210233778-210233800 CGCCCTGCGCCCGTGGGACCTGG - Intronic
1074065118 10:110007363-110007385 CGCACGCCCCCCGTGGGGCCTGG - Intronic
1074111678 10:110427154-110427176 CCCCCGAGGCCCGTGGGTCCTGG - Intergenic
1075112047 10:119596060-119596082 GGCCCTTCCCCCGTGGGCGCCGG + Intronic
1075139477 10:119818552-119818574 CGCCCCTCCCCCGCCGGGCCGGG + Intronic
1077077018 11:706499-706521 CGGCCTGCCCCCGTCGGTCCTGG + Intronic
1077147920 11:1054116-1054138 TGCCCCTCCCCCGGGGATCCGGG + Intergenic
1083922934 11:65790170-65790192 AGCCCTTCCCTGGTGGGTCCAGG - Intronic
1084967557 11:72752444-72752466 CGCCCGCCCCACGTGACTCCCGG + Intronic
1089243187 11:117098622-117098644 CGACCTTCCCGCGTGGGCCCCGG + Intergenic
1091207708 11:133832905-133832927 CGCCCGTCCCCGCTCGCTCCCGG - Intergenic
1094624162 12:32106953-32106975 CGCCCGTCCGCCATGTCTCCCGG - Intronic
1094853868 12:34394313-34394335 CGCCTGGCCCCCGTGGGCCAAGG - Intergenic
1096143832 12:49264693-49264715 GCCCCGTCCCCGGTGGGTGCGGG - Intronic
1099439793 12:82686681-82686703 CAGCCGTCGCCCTTGGGTCCCGG + Intergenic
1102013420 12:109632723-109632745 CATCCCTCCCCCTTGGGTCCAGG - Intergenic
1103779430 12:123389197-123389219 CGCCCGCCCCCCGCGCGGCCGGG - Intronic
1104373919 12:128247527-128247549 CCCCCGACCCCCGTGGGCTCCGG + Intergenic
1104898563 12:132175946-132175968 CACCTGCCCCACGTGGGTCCTGG + Intergenic
1104927495 12:132321334-132321356 CGCCCGTCTCATCTGGGTCCTGG + Intronic
1112503555 13:99959765-99959787 CGCCCCTCGCCGGTGGGCCCTGG + Intergenic
1115398206 14:32933203-32933225 CGCCCTGCCCCTCTGGGTCCCGG + Intergenic
1120135725 14:80866178-80866200 GGGCCTTCCCCCGTGGGCCCAGG + Intronic
1121074901 14:91060169-91060191 GGCGCGTGCCCCGGGGGTCCCGG - Intronic
1122097893 14:99384666-99384688 CTCCCGCCCACCGTGCGTCCAGG - Intergenic
1122298811 14:100720287-100720309 CACCCGCCCACCGAGGGTCCTGG - Intergenic
1123774192 15:23562111-23562133 CGCCCAGCCCCGCTGGGTCCTGG + Intergenic
1125502314 15:40247431-40247453 CGCCCGTCCCAGGTGCATCCTGG - Intronic
1129116681 15:73368665-73368687 CGCACGGCCCGCGCGGGTCCCGG + Exonic
1132558613 16:583549-583571 CCCCCGTCCCCAGCGGGCCCGGG + Exonic
1136365327 16:29806755-29806777 CGCCCACCCCCCGGGAGTCCAGG - Exonic
1142141052 16:88473042-88473064 CTGCCGTCCCCCGTGGGACCGGG + Intronic
1142161145 16:88558466-88558488 CGCCCGTCCCCCCGTGCTCCGGG + Intergenic
1142620436 17:1162273-1162295 CGCCTGTCCCACGTATGTCCTGG - Intronic
1142683205 17:1562257-1562279 CGTCCATGCCCCGTGGGCCCCGG + Intronic
1145077397 17:19867428-19867450 CGCCCGTCCGCTGTGTGCCCCGG - Exonic
1147998716 17:44375534-44375556 CCCCTCTGCCCCGTGGGTCCCGG + Intronic
1148783799 17:50135479-50135501 AGCCCCTACCCTGTGGGTCCTGG - Intronic
1152425034 17:80214121-80214143 CGCCCGTCAGCCCTGGGTCGGGG - Intronic
1155002907 18:21704310-21704332 CGCCCGCCCCCTGGGGGTCCCGG - Intronic
1155053865 18:22169207-22169229 CGCCCCTCCCCCGGGGTCCCTGG + Intergenic
1160860235 19:1234528-1234550 CTCCCGTCCCCCGAGGAACCGGG + Intronic
1160914905 19:1491715-1491737 CCCCCTTCCCCCGTGGACCCCGG + Intronic
1160970320 19:1765003-1765025 TGCCCGTCCTCCCTGTGTCCTGG - Intronic
1161077787 19:2294687-2294709 CGCCAATGCTCCGTGGGTCCTGG + Intronic
1163170491 19:15527618-15527640 CACCCAGCCCCCGTGGGCCCAGG - Intronic
1164693079 19:30225533-30225555 CGCCCGTCCCCCCTCAGCCCCGG + Intergenic
1165781129 19:38434829-38434851 CGCCCCTCCCCCCGGGGCCCTGG + Intronic
1166215371 19:41331204-41331226 CGCCCGCCGCCCGCAGGTCCTGG - Exonic
927714134 2:25341674-25341696 CGCCGGGCGCCCGTGGGGCCGGG - Intronic
940962158 2:159797971-159797993 CGCCCGTCCCCCGTGGGTCCTGG - Intronic
1175714671 20:61247404-61247426 CCCACGTCCCCCGTGGGACATGG + Intergenic
1175860815 20:62149155-62149177 CGCCCGTCCCCAGTGGATGCAGG + Intronic
1175867936 20:62191307-62191329 AGCCCCTCCCACGTGGGCCCCGG - Intronic
1176298568 21:5087653-5087675 CGCCCCTGCCCTGTGGGTCTGGG - Intergenic
1176567841 21:8396314-8396336 CGCCCGCCCCCGGTGGCGCCCGG + Intergenic
1179209654 21:39313983-39314005 CCGCCGCCCCCCGTGGGACCTGG + Intronic
1179822407 21:43944328-43944350 CGTCCCTCCCCCGTGGGCCCTGG + Intronic
1179858458 21:44174296-44174318 CGCCCCTGCCCTGTGGGTCTGGG + Intergenic
1180048151 21:45319080-45319102 AGCCCTTCCCCCTTGGGGCCTGG - Intergenic
1184450224 22:44578186-44578208 TGCCCCTCCCTCCTGGGTCCCGG + Intergenic
950019841 3:9779502-9779524 CCCCCCTCCCCCAAGGGTCCAGG - Intronic
954450242 3:50567685-50567707 CCCACCTCCGCCGTGGGTCCCGG - Exonic
959849742 3:111072033-111072055 CGGCCGTCCCCGCTGTGTCCTGG + Exonic
961551502 3:127672721-127672743 CGCCCGCCGCCCGCGGGGCCGGG - Exonic
963839510 3:150091197-150091219 CGACCTTCCCCCTTGGGACCAGG - Intergenic
966928354 3:184659944-184659966 TGCCCTTCCCCCTTGGGTCTGGG - Intronic
968299350 3:197601293-197601315 CCACCGTACCCCGTGAGTCCAGG - Intergenic
968599587 4:1502677-1502699 CGCCTGTGCCCCGAGGATCCTGG + Intergenic
968729072 4:2261359-2261381 GGCCGGTGCCCCGTGGGTCTGGG - Intronic
968948915 4:3680194-3680216 CGCCGGTGCCCCGTGCCTCCGGG + Intergenic
969702200 4:8773807-8773829 CGCCCGGCCCCCGTGCCTCTGGG + Intergenic
969715982 4:8868316-8868338 CGCCCGTCTCCGGTGAGTCCCGG + Exonic
979523871 4:121697222-121697244 CGCCGCTCCCCCGAGGGCCCCGG + Intergenic
981675465 4:147338408-147338430 CTCCCATTCCCAGTGGGTCCTGG + Intergenic
984917084 4:184734343-184734365 GGGCCGTCCCACGTGGCTCCCGG - Intergenic
996978162 5:129459912-129459934 CGCCCGTTCCGCGCGGGTGCAGG + Intergenic
997588227 5:135057120-135057142 CCCCCGTACCTGGTGGGTCCTGG + Intronic
1002568922 5:180129119-180129141 AGTCAGTCCCCCGTGGGCCCTGG - Intronic
1003139315 6:3457242-3457264 CGCCCCCCTCCCGTGGATCCCGG - Intergenic
1003526862 6:6905340-6905362 CTCCCATCCTCCATGGGTCCAGG + Intergenic
1004395642 6:15245129-15245151 CGTCCCTCCCCCGCGGCTCCGGG + Intergenic
1005989709 6:30895450-30895472 CGCCCGTCCCCCTCGAGGCCCGG + Exonic
1007423990 6:41735265-41735287 GGCCCCTATCCCGTGGGTCCCGG - Intronic
1013155910 6:107490757-107490779 CGCCCGCTCCCCGTGGGCCGTGG + Intronic
1016238761 6:141902611-141902633 CCCCAGTCCCCGATGGGTCCCGG + Intergenic
1019326229 7:439598-439620 CTCCCGACCCCCTTAGGTCCAGG - Intergenic
1035709415 8:1701040-1701062 CTCCCGTCCCCCGTCTGCCCTGG - Intronic
1035751752 8:2001572-2001594 CGCCCGTACCCCCGGGGTTCGGG + Exonic
1038147667 8:24913591-24913613 CGCCCGCTCCACGTGGGCCCAGG - Exonic
1041107028 8:54454067-54454089 GGCCAGTACCCCGTGGGTCCAGG - Intergenic
1041214977 8:55591374-55591396 CGCCAGTCCAGCCTGGGTCCAGG + Intergenic
1058045457 9:100352744-100352766 CGGCCGTCGCCCGTCGGGCCGGG - Intronic
1060793510 9:126500610-126500632 CACCAGTCCCCGGGGGGTCCCGG - Intronic
1061987164 9:134136366-134136388 CGGCCGTCCACCGAGGGGCCGGG - Intronic
1062321858 9:135994114-135994136 CGCCCTTCCCTCTTGTGTCCTGG + Intergenic
1062462151 9:136666459-136666481 CGCCCGGCACCCCTGGGTCGAGG + Intronic
1062656248 9:137605658-137605680 CGCCCGCCGCCCGCGAGTCCCGG - Exonic
1062713002 9:137986892-137986914 CTCCCGTCTCCCCTGGGTGCTGG + Intronic
1189446248 X:41084743-41084765 CGCCCCTCCCCCCACGGTCCCGG + Intergenic
1191252347 X:58265594-58265616 CGCCGGTCCCGCGGGGGTCTTGG - Intergenic
1201240555 Y:11953887-11953909 CGCCCTTTCCTCCTGGGTCCCGG + Intergenic