ID: 940962159

View in Genome Browser
Species Human (GRCh38)
Location 2:159797977-159797999
Sequence CCTGCACGCCCGTCCCCCGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 91}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940962159_940962168 -5 Left 940962159 2:159797977-159797999 CCCACGGGGGACGGGCGTGCAGG 0: 1
1: 0
2: 1
3: 3
4: 91
Right 940962168 2:159797995-159798017 GCAGGGAAGGGCGGGATGGCCGG 0: 1
1: 0
2: 1
3: 67
4: 1050
940962159_940962173 15 Left 940962159 2:159797977-159797999 CCCACGGGGGACGGGCGTGCAGG 0: 1
1: 0
2: 1
3: 3
4: 91
Right 940962173 2:159798015-159798037 CGGCCGGGTGTTGCGTCTGCGGG 0: 1
1: 0
2: 0
3: 3
4: 45
940962159_940962167 -9 Left 940962159 2:159797977-159797999 CCCACGGGGGACGGGCGTGCAGG 0: 1
1: 0
2: 1
3: 3
4: 91
Right 940962167 2:159797991-159798013 GCGTGCAGGGAAGGGCGGGATGG 0: 1
1: 0
2: 3
3: 44
4: 556
940962159_940962172 14 Left 940962159 2:159797977-159797999 CCCACGGGGGACGGGCGTGCAGG 0: 1
1: 0
2: 1
3: 3
4: 91
Right 940962172 2:159798014-159798036 CCGGCCGGGTGTTGCGTCTGCGG 0: 1
1: 0
2: 0
3: 2
4: 56
940962159_940962170 0 Left 940962159 2:159797977-159797999 CCCACGGGGGACGGGCGTGCAGG 0: 1
1: 0
2: 1
3: 3
4: 91
Right 940962170 2:159798000-159798022 GAAGGGCGGGATGGCCGGCCGGG 0: 1
1: 0
2: 1
3: 11
4: 294
940962159_940962176 26 Left 940962159 2:159797977-159797999 CCCACGGGGGACGGGCGTGCAGG 0: 1
1: 0
2: 1
3: 3
4: 91
Right 940962176 2:159798026-159798048 TGCGTCTGCGGGCCGCCCTCGGG 0: 1
1: 0
2: 0
3: 6
4: 77
940962159_940962175 25 Left 940962159 2:159797977-159797999 CCCACGGGGGACGGGCGTGCAGG 0: 1
1: 0
2: 1
3: 3
4: 91
Right 940962175 2:159798025-159798047 TTGCGTCTGCGGGCCGCCCTCGG 0: 1
1: 0
2: 1
3: 3
4: 40
940962159_940962169 -1 Left 940962159 2:159797977-159797999 CCCACGGGGGACGGGCGTGCAGG 0: 1
1: 0
2: 1
3: 3
4: 91
Right 940962169 2:159797999-159798021 GGAAGGGCGGGATGGCCGGCCGG 0: 1
1: 0
2: 0
3: 28
4: 537

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940962159 Original CRISPR CCTGCACGCCCGTCCCCCGT GGG (reversed) Intronic
901657637 1:10779441-10779463 CCTGCACCCACGGCCCCCGCAGG - Intronic
903597111 1:24503096-24503118 CCTGCACGCCCCGCCGCCGCAGG - Exonic
914846733 1:151287639-151287661 CCTGCCCGCCCGTCAGCCTTAGG - Exonic
916057789 1:161079934-161079956 CCTGCAGGCCGGTGCCCCGCGGG - Exonic
921039485 1:211416479-211416501 CCTGCCCCGCCGTCCCCCGCCGG - Intergenic
922804405 1:228378086-228378108 CCTGCACCCCCGTCCACCTGAGG + Intronic
1070814527 10:79314334-79314356 CCTGCTCTCCCGTCCGCTGTGGG + Exonic
1074399084 10:113126892-113126914 CCTGCCCGCCCGCCCGCCGCCGG - Intronic
1075112045 10:119596054-119596076 CCGCCAGGCCCTTCCCCCGTGGG + Intronic
1075539420 10:123299732-123299754 GCTGCACGCCCCTCCCCTCTGGG - Intergenic
1075778657 10:125003442-125003464 CCTGCACCCCCGCCCCCTGGTGG - Exonic
1076680252 10:132168052-132168074 TCTGCACGCCCGTCCCGTGGAGG + Exonic
1076811136 10:132886910-132886932 CCTGCACACCCTTCCCCTGACGG + Intronic
1077419790 11:2444872-2444894 CCTGCACGCCCCGCCCCCGCCGG - Intronic
1084154462 11:67305757-67305779 CCTGGACTCCCTTCCTCCGTGGG - Intronic
1084214786 11:67641438-67641460 CCTGCACACCCCTCCCCGGCTGG + Intergenic
1084394041 11:68897172-68897194 CCTGCACGCCTGTGCCCAGAGGG + Intronic
1093458608 12:19388143-19388165 CCTGCACTCCCTCCCCACGTTGG - Intergenic
1096714481 12:53482916-53482938 CCTGCCCTCCCGCCCTCCGTGGG - Exonic
1101679945 12:106955587-106955609 CCTGCGCGCCCCTCCTCCGGGGG - Intergenic
1103613039 12:122135599-122135621 CCTGCTCGCCCTTCCCCAGGGGG - Exonic
1104309965 12:127645759-127645781 CCTGCACACCCTTCCACCTTTGG - Intergenic
1104373914 12:128247521-128247543 CCCCCACCCCCGACCCCCGTGGG + Intergenic
1112494804 13:99896155-99896177 CCTGCTCGCCCGCCCGCCGCGGG + Exonic
1113607466 13:111620687-111620709 CCTGCATCCCTGTCCTCCGTGGG + Intronic
1118607522 14:67514825-67514847 CCTGTGCGCCCATCCCCCGCAGG + Intronic
1122842365 14:104472685-104472707 CCTGCACACCCGACGCCCGGAGG + Intergenic
1128769127 15:70268787-70268809 CCTGCACCCCCATCCCCAGGTGG + Intergenic
1128804804 15:70522748-70522770 CCTGAATGCCCCTCCCCTGTTGG - Intergenic
1129975224 15:79816088-79816110 CCTGCGAGCCTGTCCCCAGTGGG - Intergenic
1132055605 15:98648757-98648779 CCTCCACGCCCCTCCCGCGCGGG + Intergenic
1132871592 16:2117938-2117960 CCTGCACGTCTGTCCCCAGCAGG + Exonic
1133064004 16:3193211-3193233 CCTCCACGCCCGGCCCCTGCAGG + Intergenic
1134520938 16:14918957-14918979 CCTGCACGTCTGTCCCCAGCAGG - Intronic
1134550634 16:15137016-15137038 CCTGCACGTCTGTCCCCAGCAGG + Intronic
1134708613 16:16317608-16317630 CCTGCACGTCTGTCCCCAGCAGG - Intergenic
1134715827 16:16357641-16357663 CCTGCACGTCTGTCCCCAGCAGG - Intergenic
1134950991 16:18351037-18351059 CCTGCACGTCTGTCCCCAGCAGG + Intergenic
1134958930 16:18394518-18394540 CCTGCACGTCTGTCCCCAGCAGG + Intergenic
1136399915 16:30011559-30011581 TCTTCACGCCCCTCCCCCGCAGG + Intronic
1142627761 17:1203350-1203372 CCTGCGGGGCGGTCCCCCGTGGG + Intronic
1143211579 17:5191903-5191925 CCCGCCCAGCCGTCCCCCGTCGG + Intergenic
1144483716 17:15647936-15647958 CCACCACGCCCGGCCCCCTTTGG - Intronic
1147193813 17:38752025-38752047 CGTGCACGCCCTTCCTCCATTGG + Intergenic
1148018456 17:44538732-44538754 CCTGCACTCCCCACACCCGTAGG - Intergenic
1148807913 17:50273450-50273472 CCTGCTCGCCCGCGCCCCGGCGG + Intronic
1148899693 17:50866481-50866503 CCGGCACCCCGGTCCCCCGCCGG + Intronic
1151969283 17:77449580-77449602 CCACCACGCCCCTGCCCCGTGGG - Intronic
1152750802 17:82061633-82061655 CCTGCACACCCGTGTCCCGGAGG + Exonic
1157326874 18:46675528-46675550 CCTGCAGGCCAGTCCTCCCTAGG - Intronic
1157588072 18:48817881-48817903 CCAGCACCCCCTTCCCCCGTGGG + Intronic
1160373253 18:78391420-78391442 CCTGCACAGCCGTCCCCCTGGGG - Intergenic
1162761501 19:12891352-12891374 CCTGCACGTCCTTCGCACGTGGG + Exonic
1163775166 19:19213119-19213141 CCTGCCCCCACGTCCCCCGCTGG - Intronic
1166375380 19:42324532-42324554 CCTGCCCGCCCCTGCCCCATGGG + Intronic
1168356620 19:55704192-55704214 CTTGCTCACCCGCCCCCCGTTGG + Intronic
925409845 2:3633631-3633653 TCTTCACGCCGCTCCCCCGTCGG - Intronic
936520546 2:113209744-113209766 CCTGCAAGCCCGTCCCAGGCTGG + Intergenic
939866556 2:147479558-147479580 CCTGCACGTCCATCACCCATTGG + Intergenic
940962159 2:159797977-159797999 CCTGCACGCCCGTCCCCCGTGGG - Intronic
942459102 2:176157410-176157432 CCTCCACCCCCGGCCCCCGGCGG + Intronic
948599039 2:239097615-239097637 CCTGCACGCCGGACCCCTTTGGG + Intronic
1169236328 20:3932943-3932965 CCTGCAGGGCTGTCCACCGTTGG - Exonic
1172444869 20:34987697-34987719 CCTGCCCGGCTGTCCCCCATGGG - Intronic
1175383619 20:58580337-58580359 CCTGCAGTCCCGGCCCCCGCTGG - Intergenic
1176116502 20:63433956-63433978 CCTCCACGCCCGGCCCTCCTGGG - Intronic
1176306050 21:5123673-5123695 CCAGCACGGCCGGCCCCGGTCGG - Intronic
1179851007 21:44138358-44138380 CCAGCACGGCCGGCCCCGGTCGG + Intronic
1181583102 22:23838637-23838659 CCTGACCGCCCGTCCCCCGTAGG - Exonic
1183341110 22:37282392-37282414 CCTGCACACGAGACCCCCGTGGG + Exonic
1184751129 22:46487527-46487549 CGTGGACTCCCCTCCCCCGTGGG - Intronic
1185291491 22:50029963-50029985 CCACCACGCCCGGCCCCCATCGG - Intronic
955632636 3:60991085-60991107 CCTCCACCCCCGTCCCCATTAGG - Intronic
966794163 3:183698079-183698101 CGTGCGCGCCCCTCCCCCATCGG + Intronic
984973380 4:185209770-185209792 CCTGCCCCCCGGTCCCCCGCCGG - Intronic
985048571 4:185966648-185966670 CCACCACGCCCGGCCCCCATAGG + Intergenic
1001653692 5:173332142-173332164 ACTGCACGCCCCGCCCCCTTGGG + Intergenic
1001680715 5:173555125-173555147 CCTGCATGCCCGGCGCCCTTGGG - Intergenic
1002334024 5:178465811-178465833 CCTGCACGCCAGTCCCTCAGAGG - Intronic
1003220275 6:4155029-4155051 ACTGCATGCCAGTCCCCCTTGGG - Intergenic
1007381243 6:41491651-41491673 CCTGCATCCCCTTCCCCCATGGG - Intergenic
1017073841 6:150600151-150600173 CCTGCGCGCCCCTCCGCAGTGGG + Intronic
1019366697 7:636782-636804 CCTGCACGCCCCTCCCTCCTGGG + Intronic
1032398208 7:131605933-131605955 CTTGCACTCCTGTCCCCAGTGGG + Intergenic
1034273633 7:149814834-149814856 GCTGCACGCCCGGCTCCGGTGGG - Intergenic
1034508929 7:151519229-151519251 CCTGCCCGCCCGGCCCGCGGAGG + Intronic
1035221765 7:157410484-157410506 TCTGCCCGCCCACCCCCCGTGGG + Intronic
1035344414 7:158188694-158188716 CCGCCACGCCCGCCCCCTGTAGG + Intronic
1035388206 7:158488665-158488687 CCTGCACCTCAGTCCCCCGCCGG + Intronic
1047204031 8:122789119-122789141 CCTCCACCCCCTTCCCCCATTGG - Intronic
1049656407 8:143800452-143800474 CCTGGCCGCCCTTCCCCCTTCGG - Intronic
1057294653 9:93828068-93828090 CCTGCCCGCCCGCCCGCCCTGGG - Intergenic
1060524666 9:124313773-124313795 CCTGCACTCCCAGCCCCTGTAGG - Intronic
1061374117 9:130214128-130214150 CCTCCACGCCAGTCCCCCACCGG - Intronic
1185510181 X:658260-658282 CCAGCACGCCCGGCCCCAGGTGG + Intronic
1189363759 X:40372253-40372275 CCTGCACTCACTTCCCACGTTGG + Intergenic