ID: 940962161

View in Genome Browser
Species Human (GRCh38)
Location 2:159797978-159798000
Sequence CCCTGCACGCCCGTCCCCCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 175}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940962161_940962169 -2 Left 940962161 2:159797978-159798000 CCACGGGGGACGGGCGTGCAGGG 0: 1
1: 0
2: 0
3: 25
4: 175
Right 940962169 2:159797999-159798021 GGAAGGGCGGGATGGCCGGCCGG 0: 1
1: 0
2: 0
3: 28
4: 537
940962161_940962170 -1 Left 940962161 2:159797978-159798000 CCACGGGGGACGGGCGTGCAGGG 0: 1
1: 0
2: 0
3: 25
4: 175
Right 940962170 2:159798000-159798022 GAAGGGCGGGATGGCCGGCCGGG 0: 1
1: 0
2: 1
3: 11
4: 294
940962161_940962168 -6 Left 940962161 2:159797978-159798000 CCACGGGGGACGGGCGTGCAGGG 0: 1
1: 0
2: 0
3: 25
4: 175
Right 940962168 2:159797995-159798017 GCAGGGAAGGGCGGGATGGCCGG 0: 1
1: 0
2: 1
3: 67
4: 1050
940962161_940962175 24 Left 940962161 2:159797978-159798000 CCACGGGGGACGGGCGTGCAGGG 0: 1
1: 0
2: 0
3: 25
4: 175
Right 940962175 2:159798025-159798047 TTGCGTCTGCGGGCCGCCCTCGG 0: 1
1: 0
2: 1
3: 3
4: 40
940962161_940962172 13 Left 940962161 2:159797978-159798000 CCACGGGGGACGGGCGTGCAGGG 0: 1
1: 0
2: 0
3: 25
4: 175
Right 940962172 2:159798014-159798036 CCGGCCGGGTGTTGCGTCTGCGG 0: 1
1: 0
2: 0
3: 2
4: 56
940962161_940962173 14 Left 940962161 2:159797978-159798000 CCACGGGGGACGGGCGTGCAGGG 0: 1
1: 0
2: 0
3: 25
4: 175
Right 940962173 2:159798015-159798037 CGGCCGGGTGTTGCGTCTGCGGG 0: 1
1: 0
2: 0
3: 3
4: 45
940962161_940962176 25 Left 940962161 2:159797978-159798000 CCACGGGGGACGGGCGTGCAGGG 0: 1
1: 0
2: 0
3: 25
4: 175
Right 940962176 2:159798026-159798048 TGCGTCTGCGGGCCGCCCTCGGG 0: 1
1: 0
2: 0
3: 6
4: 77
940962161_940962167 -10 Left 940962161 2:159797978-159798000 CCACGGGGGACGGGCGTGCAGGG 0: 1
1: 0
2: 0
3: 25
4: 175
Right 940962167 2:159797991-159798013 GCGTGCAGGGAAGGGCGGGATGG 0: 1
1: 0
2: 3
3: 44
4: 556

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940962161 Original CRISPR CCCTGCACGCCCGTCCCCCG TGG (reversed) Intronic
900649518 1:3724024-3724046 CCCTGCACCCCCCACCCACGTGG - Intronic
901033487 1:6322183-6322205 CCCTGCACGCCAGCTCCCAGAGG + Intronic
903247322 1:22025607-22025629 CCCCGCTCCCCCGTCCTCCGAGG + Intergenic
903785435 1:25858089-25858111 CCCTGCAAGCCCCACCTCCGGGG - Intronic
904696660 1:32335329-32335351 GCCCCCACCCCCGTCCCCCGGGG + Intronic
904725296 1:32542325-32542347 CCCCGCCCCCCCGACCCCCGAGG - Intronic
904837573 1:33349379-33349401 CCCTGCGCGCCCGTCGCCCCTGG - Intronic
905797666 1:40824580-40824602 CCCTGCACCCCCATCCCTCCCGG + Intronic
906044421 1:42817080-42817102 CCCGGCCCGCCCGGCCCCAGGGG + Intronic
912591452 1:110824786-110824808 CCATGGACGCCCATCCCCCAAGG - Intergenic
915626213 1:157115541-157115563 CTCTGCACTCCCATCCCCCAAGG + Intergenic
916057791 1:161079935-161079957 CCCTGCAGGCCGGTGCCCCGCGG - Exonic
919805733 1:201380071-201380093 GCCTGCACCCCCCTCCCCTGGGG - Intronic
922190807 1:223316821-223316843 CCCTGCACAACCGTCCCTAGAGG + Intronic
922690206 1:227683045-227683067 CCCTGCAGGTCAGCCCCCCGAGG + Intergenic
1069657268 10:70099211-70099233 CTCTGCACGCCCTCCCCCAGTGG + Intronic
1075112043 10:119596053-119596075 CCCGCCAGGCCCTTCCCCCGTGG + Intronic
1077361898 11:2144528-2144550 CCCTGCACCCCCCTCCTCCCGGG - Intronic
1078762103 11:14259734-14259756 CCCTCCACGCCTGTCCCCAGTGG - Intronic
1080628529 11:34052182-34052204 CCCGACCCGCCCCTCCCCCGCGG - Intronic
1081807740 11:45899630-45899652 CCCCGCTCGCCCCTCCCCCTCGG + Intronic
1083609566 11:63998584-63998606 CCCTCCGCGCCCCGCCCCCGAGG - Exonic
1083840724 11:65302639-65302661 CCTTGGACACCCGTCCCCAGAGG - Intronic
1083922114 11:65786757-65786779 CCCAGCCGGCCCGGCCCCCGCGG - Intergenic
1084394039 11:68897171-68897193 CCCTGCACGCCTGTGCCCAGAGG + Intronic
1084423360 11:69071521-69071543 CCCTGCCCTCCCGTCCCACCAGG - Intronic
1084642978 11:70436972-70436994 CCCAGCACCCCCGGCTCCCGAGG - Intergenic
1084792670 11:71484470-71484492 CCCTGCACCCCCACCCCCAGGGG - Intronic
1089515784 11:119030605-119030627 TCCTGCACCCCCGGCCCCCGTGG - Exonic
1092875014 12:12840206-12840228 CCCTGGATGCCCGTGCCCCAGGG - Intergenic
1101679947 12:106955588-106955610 GCCTGCGCGCCCCTCCTCCGGGG - Intergenic
1103613041 12:122135600-122135622 ACCTGCTCGCCCTTCCCCAGGGG - Exonic
1103764650 12:123271621-123271643 CCCGGCGCGCCCGCCGCCCGGGG - Exonic
1103915954 12:124375876-124375898 CACTGCAGGCCCCTCCCCGGGGG - Intronic
1103926015 12:124423668-124423690 CCCTGCAAACCCCTCCCACGGGG + Intronic
1103962379 12:124617206-124617228 CCCAGCACCCCCTGCCCCCGGGG + Intergenic
1112494802 13:99896154-99896176 CCCTGCTCGCCCGCCCGCCGCGG + Exonic
1114649017 14:24271454-24271476 CCGGGCACCCCCGCCCCCCGCGG + Exonic
1118879908 14:69817275-69817297 CCCTGGAAGCAGGTCCCCCGCGG + Intergenic
1119653082 14:76397331-76397353 CCCAGCAGGCCAGTCCCCCAGGG + Intronic
1119725210 14:76918190-76918212 CCCTGGATGCCCGGCCTCCGGGG - Intergenic
1122736942 14:103848350-103848372 CCCTGCAGTCCCGTCTCCAGAGG + Intergenic
1122767477 14:104082099-104082121 CCCTCCACGCCACTCACCCGGGG + Intergenic
1122798585 14:104218532-104218554 CCCTGCACTCCCCTCCCCACAGG - Intergenic
1122920529 14:104878140-104878162 CCCTGCAGCCCGGCCCCCCGTGG + Intronic
1124580925 15:30954173-30954195 CCCTGCAAGGCCCTCCCCCAGGG + Intronic
1125182042 15:36888563-36888585 CTCTGCACGCCCCTCTGCCGCGG + Intergenic
1125508771 15:40281983-40282005 CCCTGGCCGCCCGGCCCCCGCGG - Exonic
1128526247 15:68414309-68414331 CCCTCCAGCCCCGTCCCCCCAGG - Intronic
1131066086 15:89435833-89435855 CCCAGCTCCCCCGTCCCCCAGGG + Intergenic
1131264414 15:90907123-90907145 CCCTGTGTGCCCGTCCCCTGAGG + Intronic
1131830520 15:96352077-96352099 CCCTCCACGCCCCACCCCCCCGG - Intergenic
1132055603 15:98648756-98648778 CCCTCCACGCCCCTCCCGCGCGG + Intergenic
1132544808 16:528137-528159 CCCGGCGCGCCCGGCCCCCGAGG - Intronic
1132675830 16:1120917-1120939 CCATGCAGTCCCGTCTCCCGCGG + Intergenic
1132699320 16:1215627-1215649 CCCTGCAACCCCGTCTTCCGGGG - Intronic
1132717580 16:1299570-1299592 CCCCCCGCACCCGTCCCCCGGGG + Intergenic
1132869700 16:2110386-2110408 CGCTGCACGCCCATCCCTGGGGG - Exonic
1132951515 16:2564980-2565002 CCCTGCTCCGCCGGCCCCCGGGG + Intronic
1132962835 16:2635190-2635212 CCCTGCTCCGCCGGCCCCCGGGG - Intergenic
1132997018 16:2828767-2828789 CACTGCACACCCATCCCCCAGGG - Intergenic
1134303621 16:13012969-13012991 CCCTCCACGCCCCTCCCTCCGGG - Intronic
1135407075 16:22206380-22206402 GCCTGCACGCGAGTCCCCCCTGG + Exonic
1136129469 16:28211185-28211207 CCCTGCGCTCCCATCCCCCCAGG - Intronic
1141137366 16:81474853-81474875 CCCTCCCCGCCCGCCCCCCATGG - Intronic
1141443284 16:84042855-84042877 CCCTGCAGGCCCGGCCCCGGGGG + Intergenic
1142052088 16:87965426-87965448 CCTTGCACACCCTTCCCCCACGG - Intronic
1142224643 16:88871606-88871628 CCCTGCATCCCCGAGCCCCGGGG - Intergenic
1142300886 16:89257248-89257270 CGCAGCCCGCCCGTCCCCGGAGG - Intergenic
1143519528 17:7437562-7437584 CCCTGCTCGCCCCTCGCCAGGGG + Exonic
1143845076 17:9767752-9767774 CCCTGCCAGCCAGTCCCCAGTGG + Intergenic
1144659275 17:17057998-17058020 TCCTTCACGCCCCTCCCCAGTGG + Intronic
1144778397 17:17796144-17796166 CCCCGCACGCCCGGACCCCCAGG + Exonic
1147314439 17:39612796-39612818 CCCTGCCCTCCCCTCCCCCATGG - Intergenic
1147428523 17:40357457-40357479 CCCTGTAGGCCCGTCCTGCGGGG - Intronic
1147948781 17:44095542-44095564 CCCTGCACCCCCTTTCCCCGAGG - Intronic
1148282691 17:46361385-46361407 CCAGGCACGCCCGGCTCCCGGGG + Intronic
1148304909 17:46579310-46579332 CCAGGCACGCCCGGCTCCCGGGG + Intronic
1150250311 17:63700888-63700910 CCCGGAGCACCCGTCCCCCGAGG + Intronic
1150624803 17:66835056-66835078 CCCTGCCCGCCCCTCCCTCTCGG + Intergenic
1151969285 17:77449581-77449603 CCCACCACGCCCCTGCCCCGTGG - Intronic
1157588070 18:48817880-48817902 ACCAGCACCCCCTTCCCCCGTGG + Intronic
1160201755 18:76801938-76801960 CCCTGCTCGCCCTGGCCCCGGGG - Intronic
1160298536 18:77658578-77658600 CCCTTCCCTCCCTTCCCCCGGGG - Intergenic
1160373255 18:78391421-78391443 CCCTGCACAGCCGTCCCCCTGGG - Intergenic
1160500578 18:79399683-79399705 CCCTGCGCGCCCCCGCCCCGCGG - Intronic
1160745888 19:710439-710461 CCCTGCTCGCCAGGCCCCGGAGG + Intronic
1160834945 19:1120182-1120204 GCCTGCCCGCCCGCCCCCCATGG - Intronic
1160984727 19:1833318-1833340 CCCTGCCTGCCCGTACCTCGTGG - Intronic
1161016121 19:1984579-1984601 GCCAGCACGCCCGGCCCCCAGGG + Intergenic
1161076843 19:2289958-2289980 CCCTCCCCTCCCCTCCCCCGCGG - Exonic
1161388935 19:4011333-4011355 CCCTGCCAGCCCATCCCTCGAGG + Intronic
1162033253 19:7926186-7926208 CCCTGCAGCCCCGCCCCCCGCGG - Intergenic
1162780153 19:13002555-13002577 CCCTGCCCGCCCGCCCCGCCGGG - Intronic
1165058623 19:33194426-33194448 CCCGGCGCGCCCATGCCCCGCGG - Intronic
1165157158 19:33795868-33795890 CCCAGCGCGTCCCTCCCCCGCGG + Intergenic
1165861690 19:38912338-38912360 CCCTGCACGCGCTCCCCTCGAGG + Intergenic
1166375378 19:42324531-42324553 CCCTGCCCGCCCCTGCCCCATGG + Intronic
1167748603 19:51367215-51367237 CTCCGCACCCCCGTCCCCCCAGG - Exonic
1168269421 19:55241516-55241538 CCTTGCACGCCCTACGCCCGCGG - Exonic
1168401422 19:56087992-56088014 CCCTGCCCGCCCCCCCCCCCGGG + Exonic
1168584732 19:57583475-57583497 CCCAGCTCGCCCGGCCCCCCTGG + Intronic
927893010 2:26764229-26764251 TCCTGCTCGCCCCGCCCCCGGGG - Intergenic
929911023 2:46089585-46089607 CCCTTCACGCCCTGGCCCCGGGG + Intronic
931253765 2:60553826-60553848 CTCGGCCCGCCCCTCCCCCGGGG - Intergenic
932495363 2:72143422-72143444 CCCCGCCCGCCCTTCCCCCACGG + Intronic
933666870 2:84971314-84971336 CCCTGCCCACCCCGCCCCCGCGG + Exonic
933684593 2:85133388-85133410 CCCCGCTCGCCCCTCCCCGGCGG + Exonic
936542305 2:113362243-113362265 CCTTGCACGCCTGTGCCCTGTGG + Intergenic
938140328 2:128789920-128789942 CCCTGGGCACCCGTCTCCCGGGG - Intergenic
940962161 2:159797978-159798000 CCCTGCACGCCCGTCCCCCGTGG - Intronic
941029422 2:160493858-160493880 CCCCGCCCGCCCTTCCCCCACGG - Intergenic
942453510 2:176122886-176122908 CCCTGCGCGCCTGGCCCCGGCGG - Exonic
947353670 2:229271407-229271429 CGCTGCACTCCCGCCCCGCGCGG - Intergenic
948460470 2:238127748-238127770 CCCTGCATTCCTGTCTCCCGGGG + Intronic
1168849685 20:967990-968012 GCCTGCACGACTGTCCCCCTGGG - Exonic
1168989420 20:2081339-2081361 CCATGCACGTCTGTCCCCAGAGG - Intergenic
1172033553 20:31997177-31997199 CCCTGCACGCTCTCCCGCCGAGG - Exonic
1172444871 20:34987698-34987720 CCCTGCCCGGCTGTCCCCCATGG - Intronic
1173852595 20:46228298-46228320 CCCTCCTCGCCCCTCCCCCTGGG + Intronic
1173998484 20:47357591-47357613 CCCTCCCGGCCCCTCCCCCGCGG + Intergenic
1174317288 20:49713153-49713175 CCCCGCACCCCAGTCCCCCGCGG - Intronic
1175223544 20:57431879-57431901 CCTGTCACACCCGTCCCCCGAGG + Intergenic
1175852400 20:62100525-62100547 CTCTGCATCCTCGTCCCCCGGGG - Intergenic
1175950024 20:62578419-62578441 CCCCGCTCTCCTGTCCCCCGGGG - Intergenic
1176080972 20:63272899-63272921 CCCTGCCCGCCCCTCCCTCCAGG + Exonic
1176116504 20:63433957-63433979 CCCTCCACGCCCGGCCCTCCTGG - Intronic
1179358151 21:40681387-40681409 CCCTGCAGCCCTGTCCCCGGCGG - Intronic
1179879479 21:44287426-44287448 CCCTCCACGCCCTCCCACCGCGG + Intronic
1181490462 22:23258044-23258066 CCATGCACACCTGTCCCCCCAGG - Intronic
1182706092 22:32281349-32281371 CCCTGCACGCCCAACCCCAGAGG - Intergenic
1183280250 22:36928369-36928391 CACTGCACTCCCAGCCCCCGAGG - Intronic
1183504490 22:38201848-38201870 CCCTGGAAGCCCCGCCCCCGGGG - Intronic
1184086797 22:42270371-42270393 CCCTCCCCGCCCGCCCCCGGCGG - Intronic
1184108362 22:42381569-42381591 CCCTGCAGGCCCCTGCCCCTGGG - Exonic
1184394408 22:44224433-44224455 CCCTGCATGCCCATCCCCAGAGG - Intergenic
1184751130 22:46487528-46487550 CCGTGGACTCCCCTCCCCCGTGG - Intronic
953412842 3:42699868-42699890 CCCTGCCCCACCTTCCCCCGTGG + Intronic
953613506 3:44468669-44468691 CCCTCCACCCCCTCCCCCCGAGG + Intronic
954110221 3:48429394-48429416 CGCTGCCCGCCCCTCCCGCGCGG + Exonic
954403270 3:50330584-50330606 CCCTGCACGCCTGCCCCCTTGGG - Exonic
954796139 3:53162020-53162042 CCCTGGAGGCCCGACCCGCGCGG + Intronic
958004288 3:87792772-87792794 CCCTGCCCTCCCGCGCCCCGGGG + Intergenic
962753543 3:138451673-138451695 CCCTCCACCCCAGTCCCACGCGG - Intronic
968442815 4:633160-633182 CTCTGCACCTGCGTCCCCCGAGG - Intronic
968660132 4:1795417-1795439 CCCCGCCCACCCCTCCCCCGGGG + Intronic
968850539 4:3074791-3074813 CCCGGCACGGCAGTCCCCGGAGG - Exonic
968958404 4:3730539-3730561 CCCTGCACCCCCAGCCCCCACGG - Intergenic
969295880 4:6270372-6270394 CCCGTCATGCCCCTCCCCCGCGG + Intronic
972418801 4:38867869-38867891 CCGCGCTCGCCCGCCCCCCGGGG - Intronic
976534826 4:86199581-86199603 CCCTGCACGCCCCTTCCCAGTGG - Intronic
984095483 4:175428024-175428046 CCCGGCAGGCCCGTACTCCGCGG + Intergenic
985593183 5:775797-775819 CCCTGGATGCCAGTGCCCCGAGG - Intergenic
985666081 5:1182055-1182077 CACTGCACGCCTGTGCCCTGGGG + Intergenic
985666219 5:1182766-1182788 CCCTGCACCCCGCTGCCCCGAGG + Intergenic
989240235 5:39194978-39195000 CCCTGCACGCTCGTTCTCCCAGG - Intronic
990954816 5:61331602-61331624 CTCTCCACCCGCGTCCCCCGGGG + Intergenic
992080990 5:73234138-73234160 CCCTGAAAGCCCGGGCCCCGGGG - Intergenic
999203615 5:149833225-149833247 CCCTGGTCGCCCGTCCTCGGTGG + Exonic
999767910 5:154755226-154755248 TCCTGCCCGCCCGTCGCCCAGGG + Intronic
1001653691 5:173332141-173332163 CACTGCACGCCCCGCCCCCTTGG + Intergenic
1002480648 5:179498556-179498578 CCCTTCACCCCTGTCTCCCGAGG - Intergenic
1004793088 6:19050892-19050914 CCATGGACGCCCATCCCCCAGGG + Intergenic
1006475253 6:34248905-34248927 TCCTGGAAGCCCGTCACCCGAGG + Intronic
1017073839 6:150600150-150600172 CCCTGCGCGCCCCTCCGCAGTGG + Intronic
1018837035 6:167492881-167492903 CCCAGCAAGCCGATCCCCCGGGG - Intergenic
1019366695 7:636781-636803 ACCTGCACGCCCCTCCCTCCTGG + Intronic
1019547365 7:1584970-1584992 CCCTGCACGCCCCCGCCACGTGG + Intergenic
1019892198 7:3955557-3955579 CACTGCACGCTAGTCCACCGAGG - Intronic
1025128587 7:56364103-56364125 CCCTGGGCCCCCGTCCCCAGGGG - Intergenic
1028712140 7:93921746-93921768 CCCAGCCCAGCCGTCCCCCGCGG + Exonic
1033983742 7:147197329-147197351 GCCTGCCCCCCCGCCCCCCGTGG + Intronic
1039949038 8:42153388-42153410 CCCTGCCCGCCTGCGCCCCGCGG + Intronic
1041648873 8:60281557-60281579 CCCCGCCCGCCCTTCCCCCGGGG + Intergenic
1042858995 8:73294858-73294880 CGCTGCGCACCCCTCCCCCGGGG + Exonic
1044873892 8:96645464-96645486 CTCAGCCCGCCCGACCCCCGCGG - Intronic
1049762290 8:144336935-144336957 CCCTGCGCACCCCTCCCCCCAGG - Intergenic
1053123213 9:35561076-35561098 CCCTGCCCTCCAGTCCTCCGTGG + Exonic
1053343944 9:37364282-37364304 CCCTGCTCGCCCGTCTCCATTGG - Intergenic
1056832982 9:89931532-89931554 ACCTGCACGACCCTCCTCCGAGG + Intergenic
1057181660 9:93033986-93034008 CCCTGGAGGCCCGTGCCCCAAGG - Intronic
1057294655 9:93828069-93828091 CCCTGCCCGCCCGCCCGCCCTGG - Intergenic
1060191709 9:121598244-121598266 CCGTGCAGGCCCGTCCCCAGCGG + Intronic
1060191737 9:121598390-121598412 CCCTGCACACCCCTCACCCCGGG + Intronic
1061828410 9:133275479-133275501 CCCTGAAGCCCCGTCCCCGGGGG + Intergenic
1062318507 9:135979426-135979448 CCCTGCAGCCGCGTCCCCGGGGG - Intergenic
1062412208 9:136431253-136431275 CCCGCCACGCCCGCCCCCCCAGG + Intronic
1062412254 9:136431377-136431399 CCCTCCACGCCCGCCCCCCCAGG + Intronic
1062412270 9:136431419-136431441 CCCTCCACGCCCGCCCCCCCAGG + Intronic
1062412301 9:136431502-136431524 CCCTCCACGCCCGCCCCCCCAGG + Intronic
1062412317 9:136431544-136431566 CCCGCCACGCCCGCCCCCCCAGG + Intronic
1062412333 9:136431586-136431608 CCCTCCACGCCCGCCCCCCCAGG + Intronic
1062412349 9:136431628-136431650 CCCTCCACGCCCGCCCCCCCAGG + Intronic
1062412395 9:136431752-136431774 CCCTCCACGCCCGCCCCCCCAGG + Intronic
1062412411 9:136431794-136431816 CCCTCCATGCCCGCCCCCCCAGG + Intronic
1062646549 9:137551084-137551106 AGCTGCACGCCCTTCCCCAGCGG - Intergenic
1186839553 X:13471441-13471463 CCTTGCACGCCCCTCACCCCAGG - Intergenic
1189454579 X:41174345-41174367 CCCTGCACCCCCACCCCCCATGG + Intronic
1189915491 X:45851612-45851634 CCCTGCCCGCCCATCCCCGCCGG + Intergenic
1200044989 X:153396629-153396651 CCCTCCAGGCCAGCCCCCCGTGG + Intergenic
1200107824 X:153724549-153724571 CCCTGCTCGCCCGGAGCCCGAGG - Intronic