ID: 940962173

View in Genome Browser
Species Human (GRCh38)
Location 2:159798015-159798037
Sequence CGGCCGGGTGTTGCGTCTGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 49
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 45}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940962158_940962173 21 Left 940962158 2:159797971-159797993 CCAGGACCCACGGGGGACGGGCG 0: 1
1: 0
2: 0
3: 8
4: 100
Right 940962173 2:159798015-159798037 CGGCCGGGTGTTGCGTCTGCGGG 0: 1
1: 0
2: 0
3: 3
4: 45
940962161_940962173 14 Left 940962161 2:159797978-159798000 CCACGGGGGACGGGCGTGCAGGG 0: 1
1: 0
2: 0
3: 25
4: 175
Right 940962173 2:159798015-159798037 CGGCCGGGTGTTGCGTCTGCGGG 0: 1
1: 0
2: 0
3: 3
4: 45
940962153_940962173 28 Left 940962153 2:159797964-159797986 CCCGGAGCCAGGACCCACGGGGG 0: 1
1: 0
2: 2
3: 33
4: 298
Right 940962173 2:159798015-159798037 CGGCCGGGTGTTGCGTCTGCGGG 0: 1
1: 0
2: 0
3: 3
4: 45
940962159_940962173 15 Left 940962159 2:159797977-159797999 CCCACGGGGGACGGGCGTGCAGG 0: 1
1: 0
2: 1
3: 3
4: 91
Right 940962173 2:159798015-159798037 CGGCCGGGTGTTGCGTCTGCGGG 0: 1
1: 0
2: 0
3: 3
4: 45
940962155_940962173 27 Left 940962155 2:159797965-159797987 CCGGAGCCAGGACCCACGGGGGA 0: 1
1: 0
2: 1
3: 14
4: 193
Right 940962173 2:159798015-159798037 CGGCCGGGTGTTGCGTCTGCGGG 0: 1
1: 0
2: 0
3: 3
4: 45

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940962173 Original CRISPR CGGCCGGGTGTTGCGTCTGC GGG Intronic
900171884 1:1273417-1273439 CGGCCGGGTTTCCCGTCAGCTGG - Intronic
900212235 1:1461815-1461837 GGGCCGGGTGTGGCAGCTGCAGG - Intronic
900482104 1:2904396-2904418 CGGCCGGGTGTCGGGTGAGCAGG - Intergenic
901686084 1:10944352-10944374 CGCACGGGTGTTGCCTCTGCTGG - Intergenic
905416493 1:37808027-37808049 CGCCCGGCTGTTGCGGCTCCCGG - Exonic
914868897 1:151457627-151457649 CGGCCGGGTTTTACTTCTGTAGG - Intronic
919856491 1:201709686-201709708 CTGCAGGGTGTAGCCTCTGCAGG + Intronic
919927431 1:202199502-202199524 CGGCCGGGTGGGGCGGCTGGCGG + Intronic
1067769877 10:49115473-49115495 CGGCGGGGAGATGCGGCTGCTGG - Exonic
1081911912 11:46705203-46705225 TGGCCGGGCGTTTCGTCAGCGGG + Exonic
1096777936 12:53975019-53975041 TGCCCGGGTGCTGCGGCTGCAGG + Intronic
1101131792 12:101697756-101697778 CGGCCGGGTCCTGCGACTGCCGG - Exonic
1113439580 13:110317678-110317700 CGGTTGGGGGTTGTGTCTGCAGG - Intronic
1120844145 14:89111729-89111751 CGGCCGGCTGTTCCGAGTGCGGG - Intergenic
1121449174 14:93996730-93996752 CGGCAGGGTGGTGCGTGTGGTGG + Intergenic
1129273954 15:74433458-74433480 CGCCCGGGCGTTGCGGCTCCTGG + Intronic
1140147384 16:72324547-72324569 GGGCCGGGTGTTGCCTCACCTGG + Intergenic
1141768650 16:86075115-86075137 CGGCTGGGTGATCCGTCTGGTGG + Intergenic
1142133798 16:88442615-88442637 CGCCTGGGGGCTGCGTCTGCTGG - Intergenic
1158893592 18:61894323-61894345 GGGCCGGGTGCTGGGGCTGCAGG - Intergenic
1161752835 19:6110259-6110281 CGTCCGGGTGGTGCGCCCGCGGG - Intronic
1166331202 19:42079038-42079060 TGGCCCGGAGGTGCGTCTGCCGG - Exonic
1167934775 19:52897220-52897242 CGGACAGGGGTGGCGTCTGCAGG + Intronic
940962173 2:159798015-159798037 CGGCCGGGTGTTGCGTCTGCGGG + Intronic
942186783 2:173431740-173431762 CTCCCGGGTTTTGCGGCTGCTGG - Intergenic
944624759 2:201559364-201559386 TGGCCTGGTGATGTGTCTGCTGG - Intronic
1168984860 20:2039315-2039337 GGGCCGGTTGTTGAGTCTGCTGG - Intergenic
1171173732 20:23036080-23036102 AGGCCGGGTGTGGCCACTGCAGG - Exonic
1171194337 20:23185866-23185888 AGGCCGGGTGTTGCCTCACCTGG - Intergenic
1173601577 20:44299215-44299237 CGGCCGGCTGTTCCGAGTGCGGG - Intergenic
1176388186 21:6150146-6150168 CGCCCTGGGGTTGCGTCTGAGGG - Intergenic
1179735286 21:43388102-43388124 CGCCCTGGGGTTGCGTCTGAGGG + Intergenic
963941625 3:151101667-151101689 AGGCCTGGTGGAGCGTCTGCTGG + Intronic
965609556 3:170530298-170530320 AGAGCGGGTGTTGCATCTGCTGG + Intronic
969533144 4:7740519-7740541 CGGCCGTGTGTGGGGTCTGGGGG - Exonic
969704873 4:8786201-8786223 CGACCGGCAGTGGCGTCTGCTGG - Intergenic
985678194 5:1243064-1243086 CTGCTGGGTGCAGCGTCTGCTGG - Intronic
1001589925 5:172858234-172858256 CGGCCGGCTGAAGCGGCTGCTGG + Intronic
1004224382 6:13772573-13772595 CGGCCGGCTGCTGCGAGTGCGGG - Intergenic
1016920414 6:149287614-149287636 CGGCCCTGTGTTTTGTCTGCTGG - Intronic
1017659895 6:156663670-156663692 GGGCAGGGTGTTGCCTCAGCTGG + Intergenic
1019944287 7:4314215-4314237 CGGCCGGCTGCTCCGACTGCCGG + Intergenic
1038419379 8:27422534-27422556 GGGCTGGGTGTTGGGTCTTCAGG + Intronic
1049223813 8:141440258-141440280 GGTCCGCGTGTTGAGTCTGCAGG - Intergenic
1049519592 8:143081087-143081109 CCGCTGGCTGTGGCGTCTGCTGG + Exonic
1062607916 9:137356289-137356311 CAGGCAGGTCTTGCGTCTGCAGG - Exonic
1186404893 X:9293125-9293147 CCGCCGGCTGTTTGGTCTGCCGG - Intergenic
1188005364 X:25012932-25012954 CGTCCGGGTAGTGCGTCTTCTGG + Exonic
1196735154 X:118976140-118976162 CCGCCGGGTGTTGCCCCTTCCGG + Intronic