ID: 940963378

View in Genome Browser
Species Human (GRCh38)
Location 2:159810640-159810662
Sequence ATCTTGATGAATATGTAAGA CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 221}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940963374_940963378 6 Left 940963374 2:159810611-159810633 CCGTGACCCATTCTCTTTTGCTG 0: 1
1: 0
2: 0
3: 23
4: 318
Right 940963378 2:159810640-159810662 ATCTTGATGAATATGTAAGACGG 0: 1
1: 0
2: 1
3: 27
4: 221
940963376_940963378 0 Left 940963376 2:159810617-159810639 CCCATTCTCTTTTGCTGCTGGAC 0: 1
1: 0
2: 1
3: 16
4: 233
Right 940963378 2:159810640-159810662 ATCTTGATGAATATGTAAGACGG 0: 1
1: 0
2: 1
3: 27
4: 221
940963372_940963378 22 Left 940963372 2:159810595-159810617 CCTTGTACTGGATCCACCGTGAC 0: 1
1: 0
2: 0
3: 1
4: 39
Right 940963378 2:159810640-159810662 ATCTTGATGAATATGTAAGACGG 0: 1
1: 0
2: 1
3: 27
4: 221
940963371_940963378 23 Left 940963371 2:159810594-159810616 CCCTTGTACTGGATCCACCGTGA 0: 1
1: 0
2: 0
3: 1
4: 43
Right 940963378 2:159810640-159810662 ATCTTGATGAATATGTAAGACGG 0: 1
1: 0
2: 1
3: 27
4: 221
940963377_940963378 -1 Left 940963377 2:159810618-159810640 CCATTCTCTTTTGCTGCTGGACA 0: 1
1: 0
2: 2
3: 34
4: 348
Right 940963378 2:159810640-159810662 ATCTTGATGAATATGTAAGACGG 0: 1
1: 0
2: 1
3: 27
4: 221
940963373_940963378 9 Left 940963373 2:159810608-159810630 CCACCGTGACCCATTCTCTTTTG 0: 1
1: 0
2: 1
3: 10
4: 138
Right 940963378 2:159810640-159810662 ATCTTGATGAATATGTAAGACGG 0: 1
1: 0
2: 1
3: 27
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940963378 Original CRISPR ATCTTGATGAATATGTAAGA CGG Exonic
901116917 1:6853484-6853506 AACTTGATTAATCTGAAAGAAGG + Intronic
902753734 1:18535778-18535800 ATGTTCATGACTGTGTAAGACGG - Intergenic
904234278 1:29104278-29104300 ATCTTGCTGGATAAGTAAGCCGG + Intronic
904520698 1:31093468-31093490 CTTTTGATGAAAATGTAAAATGG - Intergenic
912680200 1:111724456-111724478 ATCTTGAATAATATGCTAGATGG + Exonic
915780054 1:158538222-158538244 ATCTTGATGAGAATATAAAATGG - Intergenic
916091137 1:161308779-161308801 ATCTTGATGTATAAGGAAGAGGG - Intronic
916217335 1:162408743-162408765 CTTTAGATGAATATGCAAGATGG + Intronic
916470280 1:165117099-165117121 ATCTTGAGAGATGTGTAAGAAGG + Intergenic
916604667 1:166328849-166328871 AACTTGAGGAATCTGTAAAAAGG - Intergenic
917409138 1:174740158-174740180 GTCTCTATGAAGATGTAAGAAGG - Intronic
917804655 1:178602670-178602692 AAATTGATGAATATGTGTGATGG - Intergenic
918544381 1:185665581-185665603 ATGTTCATGAATCTGTAAAATGG - Intergenic
919245843 1:194982639-194982661 ATGTTGATGAATCTGTGAGTGGG + Intergenic
919458720 1:197850796-197850818 ATCTTCATGAATAGCTATGAAGG - Intergenic
920875013 1:209826852-209826874 AGCATGATCAAAATGTAAGATGG + Intergenic
923249760 1:232168948-232168970 AACCTGCTGAATATGTATGACGG + Intergenic
1063551685 10:7039833-7039855 GTCTTTATGAAGATGTGAGAGGG - Intergenic
1063628270 10:7711490-7711512 ATCTTGATAAAAAGGTAAAAGGG - Intronic
1068297812 10:55097405-55097427 ATGTTATTGAATATGTCAGAAGG - Intronic
1071124924 10:82322358-82322380 ATGGTGAAGAATATGTAAGTAGG + Intronic
1072765363 10:98090492-98090514 AACTTGGTGAATATTTAAGGAGG + Intergenic
1074330087 10:112497821-112497843 ACCTGGATGAATATGTAAATAGG + Intronic
1075708413 10:124517048-124517070 ATCTTGTTTAATTTGTATGATGG + Intronic
1076077200 10:127543797-127543819 ATCTTTATTACTATGTATGAGGG + Intergenic
1078189558 11:9081143-9081165 ATGTTGATGGGTATGTAAAACGG + Intronic
1078435197 11:11319159-11319181 ATCTTGCTGACTTTGTAAGACGG - Intronic
1079375641 11:19889272-19889294 ATTTTGCTGAAAATGTCAGACGG + Intronic
1080339817 11:31249187-31249209 ATCTTCATGAATATAAAAGAGGG + Intronic
1081042394 11:38227349-38227371 ATATTTATGGTTATGTAAGAAGG + Intergenic
1082222069 11:49650981-49651003 AGCTGGAAGAATATGAAAGATGG - Intergenic
1082275920 11:50221434-50221456 ATATTGATGAAAATGGAAAATGG - Intergenic
1083060305 11:59863124-59863146 ATAATGATGAATATATATGACGG - Intronic
1085103024 11:73817481-73817503 ATGTTGATGAGTATGTAAAAAGG - Intronic
1086607611 11:88715002-88715024 CACTTGATGAAAATGAAAGATGG + Intronic
1086626965 11:88968230-88968252 AGCTGGAAGAATATGAAAGATGG + Intronic
1086777828 11:90861712-90861734 ATCTAGAGGAATATATATGAAGG - Intergenic
1087828797 11:102796680-102796702 ATTTTGATGAAGATGAAAGGTGG - Exonic
1087914931 11:103799248-103799270 AATTAGATGATTATGTAAGATGG + Intergenic
1088124408 11:106406078-106406100 ATCTTAATATATATGTAAGGTGG + Intergenic
1088446976 11:109941410-109941432 ATGTTGTTGAATATTAAAGATGG - Intergenic
1089841580 11:121423448-121423470 ATCTTGATGGGAATGTAAAATGG - Intergenic
1090601282 11:128374706-128374728 CTGTTGATGAAAATGTAAAATGG - Intergenic
1092985490 12:13841371-13841393 TTATTGATGAATATGTCACACGG + Intronic
1093658847 12:21729933-21729955 ATGTTGAAGTATATTTAAGAAGG + Intronic
1094312997 12:29106421-29106443 AAAATGATGATTATGTAAGAAGG + Intergenic
1095389891 12:41693062-41693084 ATGCTAGTGAATATGTAAGAAGG - Intergenic
1095654095 12:44649072-44649094 AGCATTATGAAAATGTAAGATGG - Intronic
1095762976 12:45861409-45861431 ATCTTAATTAAATTGTAAGATGG - Intronic
1096638477 12:52975989-52976011 ACCTTGATGAAGATGCAGGATGG - Intergenic
1099354311 12:81614582-81614604 ATCTTGATGAGTAAGAAATAAGG - Intronic
1099664290 12:85607935-85607957 GTCTTGCTTTATATGTAAGAGGG - Intergenic
1105752757 13:23436617-23436639 ATATTTATAGATATGTAAGAAGG - Intergenic
1106030063 13:25992146-25992168 ATCATGATGAAAATGTAAAATGG - Intronic
1106386779 13:29294313-29294335 ATCATGATAAATATGTGAAAAGG + Intronic
1108782102 13:53848928-53848950 ATGTTGATGAAAAGGGAAGATGG + Intergenic
1109783983 13:67150876-67150898 ATCTTGTTGTATATGTAGGTTGG - Intronic
1110330252 13:74263951-74263973 ATCTTGACTAATATGAAAGTTGG + Intergenic
1111331924 13:86769735-86769757 ATCATGATGAATGTGTGATACGG + Intergenic
1111481641 13:88835055-88835077 GTGTTGATGAATATGAAAAAAGG + Intergenic
1111722741 13:91967344-91967366 ATCAAGATAAATATGTAATATGG - Intronic
1112457537 13:99575897-99575919 ATCTGAATGTAAATGTAAGAAGG - Intergenic
1112996656 13:105582674-105582696 ATCTTCAAGAAAATGAAAGAAGG + Intergenic
1113824310 13:113239262-113239284 ATCTGGTTAAATATGTGAGATGG - Intronic
1116481789 14:45399755-45399777 ATCCTGATGAATAGGCAGGATGG + Intergenic
1116634024 14:47370931-47370953 CTTTTGATGAATTTGTAATAAGG - Intronic
1117425056 14:55585316-55585338 ATCATGTGGAGTATGTAAGAGGG - Intronic
1120465967 14:84857975-84857997 ATCTTCATGAATATATAAATAGG - Intergenic
1128267996 15:66283774-66283796 GTCTTAATGAAAATGTAAAAAGG - Intergenic
1128364955 15:66992938-66992960 ATCGTGATGAAGGGGTAAGAGGG - Intergenic
1128645260 15:69374021-69374043 TTCTGGCTGAACATGTAAGACGG - Intronic
1129502140 15:76049500-76049522 TTGTTGATGAATAGGGAAGAAGG - Intronic
1130815095 15:87423110-87423132 ATCTTAAAGATTATGGAAGATGG + Intergenic
1130886563 15:88097800-88097822 AGCATGATAAATATGTAACAAGG + Intronic
1131313199 15:91309422-91309444 ATCTTCATCAATATGTATGTAGG + Intergenic
1137714122 16:50587560-50587582 ATCTTGATGGATCTGAAAGAAGG + Intronic
1138069575 16:53979380-53979402 CTCTTGATGAATCTGTAAATTGG - Intronic
1138080066 16:54082100-54082122 ATCTTCATGAATATTTAAGTAGG - Intronic
1138701563 16:58868754-58868776 ATCTTGATGCATAAATCAGATGG + Intergenic
1139174619 16:64671857-64671879 ATGTGGATGGAAATGTAAGATGG + Intergenic
1140288862 16:73631430-73631452 ATATTGATGAAAAGATAAGATGG - Intergenic
1140524479 16:75611374-75611396 ATATTTATGAATATTTAATATGG - Intronic
1140634040 16:76889614-76889636 ATATTGATAAATATTGAAGAAGG + Intergenic
1144548573 17:16219430-16219452 TTCTTAATAAATATGTAAAATGG - Intronic
1150642533 17:66959187-66959209 ATCTGGATAAATATGTGAGGAGG + Intergenic
1150831457 17:68523795-68523817 ATCTTGATGATAATGAGAGAAGG + Exonic
1151244830 17:72786456-72786478 ATCTTGATGGAAAGGCAAGATGG - Intronic
1151250474 17:72830013-72830035 CTCATGATGAATATGCAGGAAGG + Intronic
1153662993 18:7341992-7342014 AACTTGATTCATAGGTAAGAAGG + Intergenic
1155434827 18:25801486-25801508 ATCTTGAAGAACATGGAGGAGGG + Intergenic
1155641839 18:28026858-28026880 ATCTTTCTGAATATCTAGGAAGG - Intronic
1155697682 18:28702141-28702163 AACATGATGAATATGTATGCAGG + Intergenic
1156773352 18:40757181-40757203 ATCATGATGAAAATGAAACAGGG + Intergenic
1156888796 18:42165993-42166015 AACCTAAGGAATATGTAAGAGGG - Intergenic
1157936059 18:51874282-51874304 ATCATGATTAATGTGTAGGAAGG + Intergenic
1158055006 18:53268495-53268517 AGCTTATTGAATATGTAAGAAGG - Intronic
1158328758 18:56338501-56338523 ATCTTGAAAAATAAGGAAGAGGG + Intergenic
1163395580 19:17058675-17058697 ATCTTGCTGAGTTTGAAAGAAGG - Exonic
1168178656 19:54644413-54644435 GTCTTGATGAAATTGAAAGAGGG + Intronic
1168653405 19:58108852-58108874 ACCTTGATGAAGATCTAACAAGG - Intronic
925428012 2:3767138-3767160 ATCCTGATGAACATGTCCGAAGG - Intronic
925521161 2:4747376-4747398 TTTAGGATGAATATGTAAGAGGG + Intergenic
926411596 2:12608951-12608973 ATTCTGCTGAAAATGTAAGAGGG - Intergenic
926411604 2:12609003-12609025 ATTCTGCTGAAAATGTAAGAGGG - Intergenic
927391445 2:22599957-22599979 ATCCTGATGATTCTGTTAGAAGG + Intergenic
928008727 2:27587064-27587086 CTTTTGATAAATATCTAAGATGG + Intronic
930487825 2:52030337-52030359 ATTTTGTTGAATATGGAATATGG + Intergenic
932692563 2:73925802-73925824 ATGTTGATGTATATATAGGATGG - Intergenic
932971627 2:76550230-76550252 AATTTGATTAGTATGTAAGAAGG + Intergenic
933464114 2:82628961-82628983 AACTTGATGAATTTCTAAAAGGG + Intergenic
933595091 2:84275317-84275339 GTCTTGATGCAGATGGAAGAGGG - Intergenic
935204352 2:100884693-100884715 ATGTTCATGTCTATGTAAGAAGG - Intronic
935514193 2:104015505-104015527 ATCTACATGAATATGTACTATGG - Intergenic
936790587 2:116146377-116146399 AACATTATGAATATATAAGATGG + Intergenic
936949402 2:117962881-117962903 ATCTTGATACAGCTGTAAGAGGG + Intronic
937818362 2:126279078-126279100 TTCTTGATAAATAGGAAAGATGG + Intergenic
940747682 2:157587500-157587522 ATCTTAATGAAAATGGAAAAAGG + Intronic
940963378 2:159810640-159810662 ATCTTGATGAATATGTAAGACGG + Exonic
943612295 2:190047314-190047336 AGTTTGATGGATAAGTAAGAAGG - Intronic
943879852 2:193129382-193129404 ACCTTGAGTAAAATGTAAGACGG - Intergenic
945450033 2:209983735-209983757 CCCTTAATGAATATGTAAAAAGG - Intronic
946650075 2:221883876-221883898 ATCTTAATAAAAATGTCAGAGGG - Intergenic
947521377 2:230848644-230848666 ATATTGGTGAATATATAAGGAGG + Intergenic
1168736839 20:147639-147661 TTCTTGTTGAATAAGTAAGAGGG + Intergenic
1169782327 20:9322977-9322999 ATCATAAGGAATAAGTAAGATGG + Intronic
1170464172 20:16607922-16607944 GTCTTGATGTATTTTTAAGAAGG + Intergenic
1170851884 20:20012186-20012208 ATCTGTATGAATATTTAAGCCGG - Intergenic
1172513661 20:35517481-35517503 ATCTATAGGAAAATGTAAGAGGG + Exonic
1173275222 20:41574535-41574557 ATTTTGATGAATATTTGTGAGGG - Intronic
1173785088 20:45787153-45787175 ATCTTGATGCCTATGGAAGGTGG - Intronic
1174823657 20:53749302-53749324 ATGGTGATGATTAAGTAAGAAGG + Intergenic
1174874579 20:54212858-54212880 ATTTTGATGAATATGGAAGTTGG - Intronic
1176964516 21:15196559-15196581 ATTTTAAGGAATATTTAAGAAGG + Intergenic
1177390116 21:20458143-20458165 ATCATGAAGAGTATCTAAGAAGG + Intergenic
1178670639 21:34588574-34588596 CTATTGATGAAAATGTAAAATGG + Intronic
1179313982 21:40224950-40224972 CTCTTGATAAAAATGTAAGTTGG + Intronic
1181953768 22:26573445-26573467 ATCTTTATTAACATGTCAGAAGG + Intronic
1183757782 22:39785974-39785996 TTCTTGATGAATAGGAAAGAAGG - Intronic
949541169 3:5033317-5033339 ATCTTGAAGAATATATAATATGG + Intergenic
950495428 3:13331277-13331299 ATATTAATAAATATGTAAAAGGG - Intronic
950803281 3:15573280-15573302 ATTCTGAAAAATATGTAAGAAGG + Intronic
951375868 3:21916079-21916101 ATATTCATGAACATTTAAGAAGG - Intronic
953565025 3:44024889-44024911 ATTTTGATGAATAATTAAAAGGG + Intergenic
954772448 3:52984036-52984058 ATGTGGAGGAAGATGTAAGATGG + Intronic
956105574 3:65814225-65814247 ATGTAGATGAATATGAAAGAAGG - Intronic
957960638 3:87246596-87246618 ATTTTTATGAATGTGTGAGAAGG + Intronic
958540051 3:95459459-95459481 ATCTTGATAAATTAGGAAGAAGG - Intergenic
958911953 3:100004179-100004201 TTCTTGGAGAATATGTAAGGGGG - Intronic
958950951 3:100415091-100415113 ATCTTGATGACTTTGTGATAGGG + Intronic
959153983 3:102643598-102643620 ATCTTGCTGAATATGTAACAGGG + Intergenic
959669867 3:108964370-108964392 ATTTTGATGTTTATGTAATAAGG + Intronic
959780063 3:110220435-110220457 ATTTTGATGCTTAGGTAAGAGGG + Intergenic
959926695 3:111929822-111929844 ATCTAGAAGAATATGCAAGCAGG - Intronic
960945422 3:122963073-122963095 ATCTCGTTGAGTATGTAGGAGGG - Intronic
962855020 3:139337144-139337166 ATGTTGATGGAGATGTAAAATGG + Intronic
963534783 3:146513995-146514017 ATTGTGCTGAATATGAAAGAGGG + Intergenic
965381844 3:167999086-167999108 ATCTTCATGAATAACCAAGAAGG - Intergenic
965475732 3:169152636-169152658 ATCTTGATGTCTTTGTAGGACGG + Intronic
965844150 3:172942009-172942031 ATCTTGAAGAATATGAGAGAAGG + Intronic
965987446 3:174772979-174773001 TTATGGAGGAATATGTAAGATGG + Intronic
966036408 3:175422388-175422410 ATCTTAAAGCATATCTAAGATGG + Intronic
970813380 4:20123871-20123893 GTCTTGGTTAATATGCAAGAAGG - Intergenic
971542417 4:27836162-27836184 ATATTTTTGCATATGTAAGAAGG + Intergenic
971637781 4:29085028-29085050 ATGTTGATGAATATGTTGTAAGG + Intergenic
971874775 4:32292964-32292986 ATTTTTATGAATATTTAAAAAGG + Intergenic
974966124 4:68762245-68762267 ATCTTTGTGAATATGTAAAACGG + Intergenic
975508254 4:75163581-75163603 ATCTTAAAGAATAAGTAAGAGGG - Intergenic
977270420 4:94911222-94911244 ATCTTAGTGAATCTGGAAGAGGG + Intronic
977912391 4:102552573-102552595 AACTTGATAAATCTGTAACAAGG + Intronic
978312455 4:107399582-107399604 ATCTTGATTCATCTGTAAGATGG - Intergenic
978329216 4:107594081-107594103 ATCTTTTTGAATATGTAAGGAGG - Intronic
978729628 4:112010522-112010544 ATATTTTTGCATATGTAAGAAGG + Intergenic
978822669 4:112983760-112983782 ATCTTGATGAATAAAATAGAAGG + Intronic
979318775 4:119299317-119299339 ATCTTGGTGAAAATATAGGATGG + Intronic
980011301 4:127597511-127597533 ATCTAGATGTATCTGGAAGATGG + Intergenic
980415391 4:132482348-132482370 TTCTTGATGGATATGTGAGCTGG + Intergenic
980649472 4:135692501-135692523 ATATTGATGGATTTGTCAGAGGG + Intergenic
982858174 4:160412183-160412205 ATTTTGTTTAATATGTCAGAAGG + Intergenic
983121364 4:163889406-163889428 TCCTTGATGACTATGTAATAAGG + Intronic
983359024 4:166704258-166704280 ATCTATATGAATATGTTATATGG + Intergenic
983714882 4:170768655-170768677 ATCCTGATGAAACTGTTAGAAGG - Intergenic
984409760 4:179381632-179381654 AGCTTAATGAATTTGTGAGAGGG + Intergenic
985934255 5:3082688-3082710 ATTTTGAGGTATATGTGAGACGG + Intergenic
987021727 5:13879526-13879548 ATCTTTATGAATATTACAGATGG - Intronic
987180799 5:15366332-15366354 ATCTTGACAAACATGGAAGATGG + Intergenic
987882935 5:23773346-23773368 ATCTTTATGAACATGTGATATGG + Intergenic
987888439 5:23842862-23842884 ATGTTGATGGAAATGTAAAATGG + Intergenic
988448262 5:31312034-31312056 AACTTGATAAATATTTAAGAAGG - Intronic
988518798 5:31927934-31927956 ATCTTGGTGAAGATGGAGGAAGG - Intronic
990268049 5:54099956-54099978 AACTTGATGAATATTTAACTTGG - Intronic
990750127 5:59005759-59005781 AAGTTATTGAATATGTAAGAAGG - Intronic
992071037 5:73149572-73149594 ATGTTGTTGAATATGTGAGTGGG - Intergenic
992284080 5:75214688-75214710 ATCTTGATAAAGATAGAAGATGG + Intronic
992621167 5:78594508-78594530 ATTTTGATTAATTTGTTAGATGG - Intronic
994515833 5:100771851-100771873 ATCTTTATAACTATGAAAGATGG - Intergenic
996743281 5:126821916-126821938 ATGTGGATGAATATGTAATTTGG + Intronic
998009041 5:138678515-138678537 ATCTTGATGGTTATAGAAGAAGG - Intronic
998984559 5:147741449-147741471 AACTTGTTTAATATATAAGAAGG + Intronic
1006658155 6:35614661-35614683 ATCCTAGTGTATATGTAAGATGG - Intronic
1008895177 6:56544978-56545000 ATCATGATTAATATTTAACATGG - Intronic
1010542213 6:77105663-77105685 ATATAGATTAATATGTAGGAAGG - Intergenic
1012931005 6:105316671-105316693 ATCTCCATTAATATGTAACAAGG + Intronic
1013640991 6:112081182-112081204 GTCTTGATTGATATGGAAGAAGG - Exonic
1018166296 6:161100348-161100370 ACTTTGATGTATCTGTAAGACGG - Intronic
1018778780 6:167043846-167043868 ATCTTGAAGAAAATGTAATCAGG + Exonic
1019923110 7:4175192-4175214 ATGTTGATGAATGTTGAAGACGG + Intronic
1020554134 7:9649441-9649463 TTATTGATAAATATGTAGGAAGG + Intergenic
1023349440 7:39305741-39305763 ATCTCTCTGAAAATGTAAGATGG + Intronic
1024447838 7:49502319-49502341 AACTTGAAGATAATGTAAGAGGG - Intergenic
1028531036 7:91839029-91839051 TTCTTGATTAATATGTATTATGG - Intronic
1031099123 7:117457259-117457281 ATCTTAAGGAATATGCAAGGAGG - Intergenic
1032623119 7:133558299-133558321 ATCCTGTGAAATATGTAAGAGGG + Intronic
1034959193 7:155353846-155353868 ATCTTGTTAAATATTTAAGATGG + Intergenic
1036567870 8:9953120-9953142 ATCTTGAAGAATTTGAAAGAGGG - Intergenic
1036935033 8:12993485-12993507 ATCTTTATGAATATATTAGAGGG + Intronic
1038043172 8:23743953-23743975 GTCTTGATGACTATGTGAGGTGG + Intergenic
1039715648 8:40105802-40105824 ATTTTTATAAATATGCAAGAAGG + Intergenic
1040565084 8:48557755-48557777 ATTTTGATGAATTTGCCAGAAGG + Intergenic
1043281774 8:78476919-78476941 AGCTTGTTGCATATGTAAAAGGG - Intergenic
1044384041 8:91566554-91566576 ATCTAGATGAAGATGAAGGAAGG - Intergenic
1044648040 8:94465554-94465576 TTCCTGATGAAGATGTAAAATGG + Intronic
1045039448 8:98208271-98208293 ATATTGATGAAAATCTAAGAGGG - Intronic
1047194178 8:122706431-122706453 ATTTTGATGATGATGGAAGAAGG + Intergenic
1047905012 8:129463574-129463596 ATAATAATGAAAATGTAAGAAGG - Intergenic
1048147956 8:131863946-131863968 CTCTTGCTGAAAATGGAAGAAGG - Intergenic
1049291599 8:141805938-141805960 AATTTGATGACTATGAAAGATGG - Intergenic
1050402379 9:5270127-5270149 ATCTTAAGGAATATGTGAGCTGG - Intergenic
1050653780 9:7801197-7801219 ATCTTTATGAACAACTAAGAAGG - Intronic
1050871406 9:10575277-10575299 ATCTTGAAGAATATGAAAGTTGG + Intronic
1051908555 9:22126262-22126284 TTCATGATGAATATGTGAAAGGG + Intergenic
1053034516 9:34812948-34812970 ATCTTGAGGAAAATGTCAGGTGG - Intergenic
1053254217 9:36602169-36602191 CTGTTGGTGAAAATGTAAGATGG - Intronic
1054736318 9:68753959-68753981 ATCATGAAGAATATTCAAGAAGG - Intronic
1055602469 9:77934074-77934096 CTCTTGATGAATATGCAATAAGG - Intronic
1055629372 9:78207551-78207573 ATCATGATGAATGTGTATGGTGG + Intergenic
1056091178 9:83207499-83207521 CTCTTGCTGAATATGTTAGAGGG - Intergenic
1060000687 9:119955851-119955873 ATCTTAATCACTATGTTAGATGG + Intergenic
1061471705 9:130831924-130831946 ATCTGTATGCATATGTAAGATGG - Intronic
1202798466 9_KI270719v1_random:149395-149417 TTCTTTAAGAATATGTCAGACGG + Intergenic
1188867421 X:35330337-35330359 ATACTGATGAACATTTAAGATGG + Intergenic
1188942216 X:36254214-36254236 ACCTTGAAGAATATGGCAGAGGG + Intronic
1189830354 X:44966675-44966697 AGCTTGATTAATGTGTAATAGGG + Intronic
1190455289 X:50621419-50621441 ATCTGGAAGAATAAGTAAGTGGG - Intronic
1191912638 X:66167229-66167251 ATCTTGAGAATTATATAAGATGG + Intronic
1194454759 X:94089098-94089120 ATCAGGCTGAATATGTAACATGG - Intergenic
1194703974 X:97152103-97152125 TTATTGATGAATATATCAGAGGG - Intronic
1197634158 X:128895954-128895976 ATCATAATCAATATGTAACAAGG - Intergenic
1198622010 X:138523100-138523122 ATCTTGATTAATACGCAAAAGGG + Intergenic
1198894142 X:141432201-141432223 ATCTTGATTAATATGTAGTTTGG - Intergenic
1199013692 X:142786838-142786860 ATTTTCATGAAGATGTGAGAGGG + Intergenic